CU091729 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CAAGCAATCCAGAAAATCTAAGGTTAGCCCTTTCTCTTGCCATCTCTAATGTGATCAGCTTTTGAACTAGCTTCGCCGCCATCGTCGAGAGCATTCAAGTTCAGACTTAAATCCAAAGTGCTTTCGTTCAAATCTTGACGCACTGGACGATCGTTGTCCTGAGACTGACTTTTCTTCCATTGGCACGTCATTAATATCTGGTTTCTCATCTTGAAGCCTCCCCCTTGGTTGCTACTGTACTACTTGGTTCAACATCATCTGATTCTAAAGCTTCATCTTCGACATTATCAGTGGCTTCATTTTCTGCAGCCTTCGTTTTTTTGTTCCTCTAACACAGCAATCGGCATGTATTTTAAATTTTCGGCGAGGAGGCTCCTCTGTCACCGGTTGGGG
BLAST of CU091729 vs. TrEMBL
Match: A0A0A0LVV2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G195230 PE=4 SV=1) HSP 1 Score: 72.4 bits (176), Expect = 4.6e-10 Identity = 36/50 (72.00%), Postives = 38/50 (76.00%), Query Frame = -2
BLAST of CU091729 vs. TrEMBL
Match: A0A0A0LVV2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G195230 PE=4 SV=1) HSP 1 Score: 65.9 bits (159), Expect = 4.3e-08 Identity = 32/36 (88.89%), Postives = 34/36 (94.44%), Query Frame = -3
HSP 2 Score: 38.5 bits (88), Expect = 7.4e+00 Identity = 16/18 (88.89%), Postives = 17/18 (94.44%), Query Frame = -1
BLAST of CU091729 vs. NCBI nr
Match: gi|449465421|ref|XP_004150426.1| (PREDICTED: uncharacterized protein LOC101221727 isoform X1 [Cucumis sativus]) HSP 1 Score: 83.6 bits (205), Expect = 2.8e-13 Identity = 51/109 (46.79%), Postives = 59/109 (54.13%), Query Frame = -2
BLAST of CU091729 vs. NCBI nr
Match: gi|659118143|ref|XP_008458968.1| (PREDICTED: uncharacterized protein LOC103498224 isoform X1 [Cucumis melo]) HSP 1 Score: 80.1 bits (196), Expect = 3.1e-12 Identity = 48/109 (44.04%), Postives = 58/109 (53.21%), Query Frame = -2
BLAST of CU091729 vs. NCBI nr
Match: gi|659118145|ref|XP_008458970.1| (PREDICTED: uncharacterized protein LOC103498224 isoform X2 [Cucumis melo]) HSP 1 Score: 75.9 bits (185), Expect = 5.9e-11 Identity = 46/109 (42.20%), Postives = 58/109 (53.21%), Query Frame = -2
BLAST of CU091729 vs. NCBI nr
Match: gi|700209983|gb|KGN65079.1| (hypothetical protein Csa_1G195230 [Cucumis sativus]) HSP 1 Score: 71.6 bits (174), Expect = 1.1e-09 Identity = 36/50 (72.00%), Postives = 38/50 (76.00%), Query Frame = -2
BLAST of CU091729 vs. NCBI nr
Match: gi|778659850|ref|XP_011655175.1| (PREDICTED: uncharacterized protein LOC101221727 isoform X2 [Cucumis sativus]) HSP 1 Score: 68.6 bits (166), Expect = 9.5e-09 Identity = 34/47 (72.34%), Postives = 35/47 (74.47%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|