CU091717 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CCTTCCACTGGATGATTATACAAAGCCCCAAATGCATATGGAACAACAAGCCTATGGTGCTGAGAATGAATGTGTCTGTACAGAAACTTGTTATGATGCATGTATCGGTGTGCAAAGTACTGCCACGTGTCTAGAATGAACATCGCAGCTAAAAATTGCAAAACAACCATTGGCCATGACTTTGGAACTGCATTGCTTCCATCATCATTTCCAGTCAACTTAAAGAGGATGATGGCGACAATAGCCTGAATGAATTGCTAGAAAAAGACCGCCCCGAAAAC
BLAST of CU091717 vs. Swiss-Prot
Match: SBH1_ARATH (Sphinganine C4-monooxygenase 1 OS=Arabidopsis thaliana GN=SBH1 PE=1 SV=1) HSP 1 Score: 112.8 bits (281), Expect = 2.0e-24 Identity = 50/76 (65.79%), Postives = 60/76 (78.95%), Query Frame = -1
BLAST of CU091717 vs. Swiss-Prot
Match: SBH2_ARATH (Sphinganine C4-monooxygenase 2 OS=Arabidopsis thaliana GN=SBH2 PE=1 SV=1) HSP 1 Score: 110.5 bits (275), Expect = 9.7e-24 Identity = 48/76 (63.16%), Postives = 59/76 (77.63%), Query Frame = -1
BLAST of CU091717 vs. Swiss-Prot
Match: SUR2_SCHPO (Sphingolipid C4-hydroxylase sur2 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) GN=sur2 PE=3 SV=1) HSP 1 Score: 84.7 bits (208), Expect = 5.7e-16 Identity = 35/52 (67.31%), Postives = 39/52 (75.00%), Query Frame = -1
BLAST of CU091717 vs. Swiss-Prot
Match: SUR2_YEAST (Sphingolipid C4-hydroxylase SUR2 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) GN=SUR2 PE=1 SV=1) HSP 1 Score: 77.4 bits (189), Expect = 9.1e-14 Identity = 33/56 (58.93%), Postives = 37/56 (66.07%), Query Frame = -1
BLAST of CU091717 vs. TrEMBL
Match: A0A0A0LJX9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G101090 PE=3 SV=1) HSP 1 Score: 164.9 bits (416), Expect = 4.8e-38 Identity = 74/75 (98.67%), Postives = 74/75 (98.67%), Query Frame = -1
BLAST of CU091717 vs. TrEMBL
Match: M5XMN9_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa010258mg PE=3 SV=1) HSP 1 Score: 128.3 bits (321), Expect = 5.0e-27 Identity = 56/75 (74.67%), Postives = 63/75 (84.00%), Query Frame = -1
BLAST of CU091717 vs. TrEMBL
Match: D7TN95_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_01s0026g02310 PE=3 SV=1) HSP 1 Score: 124.8 bits (312), Expect = 5.5e-26 Identity = 57/76 (75.00%), Postives = 64/76 (84.21%), Query Frame = -1
BLAST of CU091717 vs. TrEMBL
Match: A0A0A0KQL6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G605020 PE=3 SV=1) HSP 1 Score: 124.0 bits (310), Expect = 9.5e-26 Identity = 53/75 (70.67%), Postives = 61/75 (81.33%), Query Frame = -1
BLAST of CU091717 vs. TrEMBL
Match: W9R575_9ROSA (Sphingoid base hydroxylase 2 OS=Morus notabilis GN=L484_003193 PE=3 SV=1) HSP 1 Score: 123.6 bits (309), Expect = 1.2e-25 Identity = 56/76 (73.68%), Postives = 63/76 (82.89%), Query Frame = -1
BLAST of CU091717 vs. NCBI nr
Match: gi|449442297|ref|XP_004138918.1| (PREDICTED: sphinganine C(4)-monooxygenase 1-like [Cucumis sativus]) HSP 1 Score: 160.6 bits (405), Expect = 1.3e-36 Identity = 74/75 (98.67%), Postives = 74/75 (98.67%), Query Frame = -1
BLAST of CU091717 vs. NCBI nr
Match: gi|700206260|gb|KGN61379.1| (hypothetical protein Csa_2G101090 [Cucumis sativus]) HSP 1 Score: 160.6 bits (405), Expect = 1.3e-36 Identity = 74/75 (98.67%), Postives = 74/75 (98.67%), Query Frame = -1
BLAST of CU091717 vs. NCBI nr
Match: gi|659082180|ref|XP_008441706.1| (PREDICTED: sphinganine C(4)-monooxygenase 1-like [Cucumis melo]) HSP 1 Score: 159.1 bits (401), Expect = 3.8e-36 Identity = 72/75 (96.00%), Postives = 74/75 (98.67%), Query Frame = -1
BLAST of CU091717 vs. NCBI nr
Match: gi|645229801|ref|XP_008221629.1| (PREDICTED: sphinganine C(4)-monooxygenase 1-like [Prunus mume]) HSP 1 Score: 124.0 bits (310), Expect = 1.4e-25 Identity = 56/75 (74.67%), Postives = 63/75 (84.00%), Query Frame = -1
BLAST of CU091717 vs. NCBI nr
Match: gi|596288798|ref|XP_007225995.1| (hypothetical protein PRUPE_ppa010258mg [Prunus persica]) HSP 1 Score: 124.0 bits (310), Expect = 1.4e-25 Identity = 56/75 (74.67%), Postives = 63/75 (84.00%), Query Frame = -1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|