CU091110 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
ATGTGTAACAATAGAATCCAATCCATACCTTGTGTCTTTATTCGACTTAATTATAGCTACACTTCTGCCATTGCAGCTCTCGGACTGAATCCGCCGAAGAAGAGTGGTAGTTTTCCCAGCAAACATCGGCCCCAGAATGACATGAATCTCGCCAGAGGGCGGTGACAAAGAGGCCCTCATCTGGGGGTTTCGATTCTGGGTTGAAAAAAACCCTTTCGAGGGCAACGAAATAGTGGGTGTTTTGAAAGTGAAAAAATTAGAGAGTTGGGTGAACATAGGGCCGCATTGCGCAG
BLAST of CU091110 vs. Swiss-Prot
Match: KITHB_ARATH (Thymidine kinase b OS=Arabidopsis thaliana GN=TK1B PE=1 SV=1) HSP 1 Score: 82.4 bits (202), Expect = 3.0e-15 Identity = 45/78 (57.69%), Postives = 54/78 (69.23%), Query Frame = -3
BLAST of CU091110 vs. Swiss-Prot
Match: KITH_ORYSJ (Thymidine kinase OS=Oryza sativa subsp. japonica GN=TK PE=2 SV=2) HSP 1 Score: 80.5 bits (197), Expect = 1.1e-14 Identity = 43/61 (70.49%), Postives = 48/61 (78.69%), Query Frame = -3
BLAST of CU091110 vs. Swiss-Prot
Match: KITHA_ARATH (Thymidine kinase a OS=Arabidopsis thaliana GN=TK1A PE=1 SV=1) HSP 1 Score: 79.7 bits (195), Expect = 1.9e-14 Identity = 36/52 (69.23%), Postives = 45/52 (86.54%), Query Frame = -3
BLAST of CU091110 vs. Swiss-Prot
Match: KITH_SWPVK (Thymidine kinase OS=Swinepox virus (strain Kasza) GN=TK PE=3 SV=1) HSP 1 Score: 52.8 bits (125), Expect = 2.5e-06 Identity = 24/51 (47.06%), Postives = 32/51 (62.75%), Query Frame = -3
BLAST of CU091110 vs. TrEMBL
Match: A0A0A0LYL4_CUCSA (Thymidine kinase OS=Cucumis sativus GN=Csa_1G181480 PE=3 SV=1) HSP 1 Score: 198.4 bits (503), Expect = 4.1e-48 Identity = 97/97 (100.00%), Postives = 97/97 (100.00%), Query Frame = -3
BLAST of CU091110 vs. TrEMBL
Match: A0A067GT29_CITSI (Thymidine kinase OS=Citrus sinensis GN=CISIN_1g023563mg PE=3 SV=1) HSP 1 Score: 112.8 bits (281), Expect = 2.3e-22 Identity = 56/74 (75.68%), Postives = 62/74 (83.78%), Query Frame = -3
BLAST of CU091110 vs. TrEMBL
Match: A0A067GSQ2_CITSI (Thymidine kinase OS=Citrus sinensis GN=CISIN_1g023563mg PE=3 SV=1) HSP 1 Score: 112.8 bits (281), Expect = 2.3e-22 Identity = 56/74 (75.68%), Postives = 62/74 (83.78%), Query Frame = -3
BLAST of CU091110 vs. TrEMBL
Match: A0A067LDR5_JATCU (Thymidine kinase OS=Jatropha curcas GN=JCGZ_02929 PE=3 SV=1) HSP 1 Score: 108.6 bits (270), Expect = 4.3e-21 Identity = 59/86 (68.60%), Postives = 65/86 (75.58%), Query Frame = -3
BLAST of CU091110 vs. TrEMBL
Match: I1L012_SOYBN (Thymidine kinase OS=Glycine max GN=GLYMA_09G011500 PE=3 SV=1) HSP 1 Score: 104.0 bits (258), Expect = 1.1e-19 Identity = 61/105 (58.10%), Postives = 74/105 (70.48%), Query Frame = -3
BLAST of CU091110 vs. NCBI nr
Match: gi|778659746|ref|XP_011654956.1| (PREDICTED: thymidine kinase [Cucumis sativus]) HSP 1 Score: 199.1 bits (505), Expect = 3.5e-48 Identity = 97/97 (100.00%), Postives = 97/97 (100.00%), Query Frame = -3
BLAST of CU091110 vs. NCBI nr
Match: gi|700209940|gb|KGN65036.1| (Thymidine kinase [Cucumis sativus]) HSP 1 Score: 199.1 bits (505), Expect = 3.5e-48 Identity = 97/97 (100.00%), Postives = 97/97 (100.00%), Query Frame = -3
BLAST of CU091110 vs. NCBI nr
Match: gi|659127259|ref|XP_008463610.1| (PREDICTED: thymidine kinase-like [Cucumis melo]) HSP 1 Score: 192.6 bits (488), Expect = 3.2e-46 Identity = 93/97 (95.88%), Postives = 95/97 (97.94%), Query Frame = -3
BLAST of CU091110 vs. NCBI nr
Match: gi|641859797|gb|KDO78487.1| (hypothetical protein CISIN_1g023563mg [Citrus sinensis]) HSP 1 Score: 113.6 bits (283), Expect = 1.9e-22 Identity = 56/74 (75.68%), Postives = 62/74 (83.78%), Query Frame = -3
BLAST of CU091110 vs. NCBI nr
Match: gi|568825895|ref|XP_006467312.1| (PREDICTED: thymidine kinase [Citrus sinensis]) HSP 1 Score: 113.6 bits (283), Expect = 1.9e-22 Identity = 56/74 (75.68%), Postives = 62/74 (83.78%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|