CU090558 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GATAACAAAACACACAGCTTCCCCCCCATATCTAATTCAAATCCTTCTCTTAACCATCAATTGAAATCATGGTCGCCTCATTGAAGCTGCCAATCATATTCCTAGTTTGCATAGCCATTTTAGCATTACCTGTGATGACACGTACCACGACAACGCTTGATCAGTTCTCAACCAAGGATGTCGCATCGGTGAACTGCACGGTTGTTTA
BLAST of CU090558 vs. TrEMBL
Match: A0A0A0LTE1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G263980 PE=4 SV=1) HSP 1 Score: 89.0 bits (219), Expect = 2.5e-15 Identity = 45/45 (100.00%), Postives = 45/45 (100.00%), Query Frame = 3
BLAST of CU090558 vs. NCBI nr
Match: gi|700210099|gb|KGN65195.1| (hypothetical protein Csa_1G263980 [Cucumis sativus]) HSP 1 Score: 82.8 bits (203), Expect = 2.5e-13 Identity = 45/45 (100.00%), Postives = 45/45 (100.00%), Query Frame = 3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|