CU090401 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGAAGACCTTTGCTGCTAGGGCTCCAAGTCTCCTTCTTTCTTCACTTTCGGAAAACCACATTTCTGTCCATTACTCCGTGATTCTCTATAATCCGAAGGCCCTGAACCCTAACCACCATGTTGTCAGGGGATATACCGCCTAACCAGACCATATACATCAAGAATCTCAACGAGAAGGTCAAAGAAAAGAAGAATTGAAGAGATCCCTGTATGCTTTTGTTTTCTCAATATGGAAGAATCCTTGATGTTGTTGCCTTGAGGACACCGAGGCTTAGAGGGCAAGCATGGGTTGTC
BLAST of CU090401 vs. Swiss-Prot
Match: RU2B_ORYSI (U2 small nuclear ribonucleoprotein B'' OS=Oryza sativa subsp. indica GN=OsI_11177 PE=3 SV=1) HSP 1 Score: 68.6 bits (166), Expect = 4.5e-11 Identity = 36/59 (61.02%), Postives = 38/59 (64.41%), Query Frame = 1
BLAST of CU090401 vs. Swiss-Prot
Match: RU2B_ORYSJ (U2 small nuclear ribonucleoprotein B'' OS=Oryza sativa subsp. japonica GN=Os03g0298800 PE=2 SV=1) HSP 1 Score: 68.6 bits (166), Expect = 4.5e-11 Identity = 36/59 (61.02%), Postives = 38/59 (64.41%), Query Frame = 1
BLAST of CU090401 vs. Swiss-Prot
Match: RU2B2_ARATH (U2 small nuclear ribonucleoprotein B'' 2 OS=Arabidopsis thaliana GN=At1g06960 PE=1 SV=1) HSP 1 Score: 65.5 bits (158), Expect = 3.8e-10 Identity = 34/59 (57.63%), Postives = 38/59 (64.41%), Query Frame = 1
BLAST of CU090401 vs. Swiss-Prot
Match: RU2B1_ARATH (U2 small nuclear ribonucleoprotein B'' OS=Arabidopsis thaliana GN=U2B'' PE=1 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 6.4e-10 Identity = 34/58 (58.62%), Postives = 37/58 (63.79%), Query Frame = 1
BLAST of CU090401 vs. TrEMBL
Match: A0A0K9PZW3_ZOSMR (U1 small nuclear ribonucleoprotein A OS=Zostera marina GN=ZOSMA_141G00120 PE=4 SV=1) HSP 1 Score: 72.8 bits (177), Expect = 2.6e-10 Identity = 39/59 (66.10%), Postives = 41/59 (69.49%), Query Frame = 1
BLAST of CU090401 vs. TrEMBL
Match: A0A0A0LPT7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G025950 PE=4 SV=1) HSP 1 Score: 72.4 bits (176), Expect = 3.4e-10 Identity = 39/58 (67.24%), Postives = 40/58 (68.97%), Query Frame = 1
BLAST of CU090401 vs. TrEMBL
Match: A0A0L9UWR4_PHAAN (Uncharacterized protein OS=Phaseolus angularis GN=LR48_Vigan07g091700 PE=4 SV=1) HSP 1 Score: 72.4 bits (176), Expect = 3.4e-10 Identity = 39/58 (67.24%), Postives = 40/58 (68.97%), Query Frame = 1
BLAST of CU090401 vs. TrEMBL
Match: A0A0S3RLE1_PHAAN (Uncharacterized protein OS=Vigna angularis var. angularis GN=Vigan.03G112800 PE=4 SV=1) HSP 1 Score: 72.4 bits (176), Expect = 3.4e-10 Identity = 39/58 (67.24%), Postives = 40/58 (68.97%), Query Frame = 1
BLAST of CU090401 vs. TrEMBL
Match: V7BC82_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_008G251100g PE=4 SV=1) HSP 1 Score: 71.2 bits (173), Expect = 7.7e-10 Identity = 38/58 (65.52%), Postives = 40/58 (68.97%), Query Frame = 1
BLAST of CU090401 vs. NCBI nr
Match: gi|672118741|ref|XP_008782587.1| (PREDICTED: U2 small nuclear ribonucleoprotein B'' [Phoenix dactylifera]) HSP 1 Score: 74.7 bits (182), Expect = 1.0e-10 Identity = 39/62 (62.90%), Postives = 42/62 (67.74%), Query Frame = 1
BLAST of CU090401 vs. NCBI nr
Match: gi|950986758|ref|XP_014503638.1| (PREDICTED: U2 small nuclear ribonucleoprotein B'' 2 [Vigna radiata var. radiata]) HSP 1 Score: 73.9 bits (180), Expect = 1.7e-10 Identity = 39/58 (67.24%), Postives = 40/58 (68.97%), Query Frame = 1
BLAST of CU090401 vs. NCBI nr
Match: gi|920703988|gb|KOM47213.1| (hypothetical protein LR48_Vigan07g091700 [Vigna angularis]) HSP 1 Score: 73.9 bits (180), Expect = 1.7e-10 Identity = 39/58 (67.24%), Postives = 40/58 (68.97%), Query Frame = 1
BLAST of CU090401 vs. NCBI nr
Match: gi|658046538|ref|XP_008358937.1| (PREDICTED: U2 small nuclear ribonucleoprotein B''-like [Malus domestica]) HSP 1 Score: 73.9 bits (180), Expect = 1.7e-10 Identity = 39/58 (67.24%), Postives = 40/58 (68.97%), Query Frame = 1
BLAST of CU090401 vs. NCBI nr
Match: gi|965665925|dbj|BAT81413.1| (hypothetical protein VIGAN_03112800 [Vigna angularis var. angularis]) HSP 1 Score: 73.9 bits (180), Expect = 1.7e-10 Identity = 39/58 (67.24%), Postives = 40/58 (68.97%), Query Frame = 1
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|