CU090252 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AAAGAGTATCAGTGGGGACAGCAATTAACCTTTTCCCAGCTTTAAGAGCATCTGTAGCCTCTTGAGCAAAAGCTTCAGAGGCAGGACGAAGTGCTTGCAAACAATTCTCCACACGCATACAACACTTCTCTAAACTCCAATTCGTTTTTAAGAAAACTTAACCCTTGATCCTCTATTTCGTTGCAAGAACGAAACTATCCCATAATTGGAAGAACCCAGTTGAGAAGAGGGAAAAGTTGTAAACGTTCTGAATTAAGAGAGAGACTGTCA
BLAST of CU090252 vs. TrEMBL
Match: A0A0A0LUP4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G077210 PE=4 SV=1) HSP 1 Score: 98.6 bits (244), Expect = 4.1e-18 Identity = 49/51 (96.08%), Postives = 50/51 (98.04%), Query Frame = -3
BLAST of CU090252 vs. TrEMBL
Match: A0A0A0LUP4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G077210 PE=4 SV=1) HSP 1 Score: 47.0 bits (110), Expect = 1.4e-02 Identity = 22/23 (95.65%), Postives = 22/23 (95.65%), Query Frame = -1
HSP 2 Score: 59.7 bits (143), Expect = 2.1e-06 Identity = 31/49 (63.27%), Postives = 39/49 (79.59%), Query Frame = -3
BLAST of CU090252 vs. NCBI nr
Match: gi|449462123|ref|XP_004148791.1| (PREDICTED: yrdC domain-containing protein, mitochondrial [Cucumis sativus]) HSP 1 Score: 98.6 bits (244), Expect = 5.8e-18 Identity = 49/51 (96.08%), Postives = 50/51 (98.04%), Query Frame = -3
BLAST of CU090252 vs. NCBI nr
Match: gi|659130663|ref|XP_008465284.1| (PREDICTED: yrdC domain-containing protein, mitochondrial [Cucumis melo]) HSP 1 Score: 94.0 bits (232), Expect = 1.4e-16 Identity = 47/51 (92.16%), Postives = 49/51 (96.08%), Query Frame = -3
BLAST of CU090252 vs. NCBI nr
Match: gi|802551497|ref|XP_012064831.1| (PREDICTED: LOW QUALITY PROTEIN: yrdC domain-containing protein, mitochondrial [Jatropha curcas]) HSP 1 Score: 59.7 bits (143), Expect = 3.0e-06 Identity = 31/49 (63.27%), Postives = 39/49 (79.59%), Query Frame = -3
BLAST of CU090252 vs. NCBI nr
Match: gi|643738073|gb|KDP44061.1| (hypothetical protein JCGZ_05528 [Jatropha curcas]) HSP 1 Score: 59.7 bits (143), Expect = 3.0e-06 Identity = 31/49 (63.27%), Postives = 39/49 (79.59%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|