CU089582 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGGTTTAGGGGATACTGACGATACGTCTTTAGGACCGGGAGGCGATCTTCGGGTTTTTCTGGAAGGTTTATCCATGGCAGAAAACGTTCAAAAATACGTTGAGCAGAATCGGTTTGGCCAACGTCCCATTACAGAAAAGAACGCGTCTTGGAAGTTTTATAGACGGATCATATATTTTGTTTGAGCGAAAAAATAGATCAGGAGAATAACAATTCTTTCCAATGGAACTGAAAAGGTAAACTTGAGAGGCATTTTCTATTGTCATCTTTTTGGTATATCTTCTTGTATGAATGGAAACAGTGTTACATGTTAGTTTGGCCCCTGATGTTGAAAGGATTTTTATGCATTAAAGGATCAATTTCTAACCTCGAC
BLAST of CU089582 vs. TrEMBL
Match: A0A0A0LSV7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G039290 PE=4 SV=1) HSP 1 Score: 120.6 bits (301), Expect = 1.4e-24 Identity = 57/57 (100.00%), Postives = 57/57 (100.00%), Query Frame = 2
BLAST of CU089582 vs. TrEMBL
Match: A0A0A0LSV7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G039290 PE=4 SV=1) HSP 1 Score: 33.1 bits (74), Expect = 2.9e+02 Identity = 13/19 (68.42%), Postives = 15/19 (78.95%), Query Frame = 1
HSP 2 Score: 94.7 bits (234), Expect = 8.1e-17 Identity = 42/54 (77.78%), Postives = 49/54 (90.74%), Query Frame = 2
BLAST of CU089582 vs. TrEMBL
Match: A0A0V0I5L2_SOLCH (Putative ovule protein OS=Solanum chacoense PE=4 SV=1) HSP 1 Score: 94.7 bits (234), Expect = 8.1e-17 Identity = 42/54 (77.78%), Postives = 49/54 (90.74%), Query Frame = 2
BLAST of CU089582 vs. TrEMBL
Match: K4C8B8_SOLLC (Uncharacterized protein OS=Solanum lycopersicum PE=4 SV=1) HSP 1 Score: 93.6 bits (231), Expect = 1.8e-16 Identity = 41/54 (75.93%), Postives = 49/54 (90.74%), Query Frame = 2
BLAST of CU089582 vs. TrEMBL
Match: M0ZY00_SOLTU (Uncharacterized protein OS=Solanum tuberosum GN=PGSC0003DMG402004066 PE=4 SV=1) HSP 1 Score: 91.7 bits (226), Expect = 6.9e-16 Identity = 41/54 (75.93%), Postives = 48/54 (88.89%), Query Frame = 2
BLAST of CU089582 vs. NCBI nr
Match: gi|778657080|ref|XP_004137602.2| (PREDICTED: uncharacterized protein LOC101203219 isoform X2 [Cucumis sativus]) HSP 1 Score: 121.3 bits (303), Expect = 1.2e-24 Identity = 57/57 (100.00%), Postives = 57/57 (100.00%), Query Frame = 2
BLAST of CU089582 vs. NCBI nr
Match: gi|659066593|ref|XP_008451760.1| (PREDICTED: uncharacterized protein LOC103492827 isoform X2 [Cucumis melo]) HSP 1 Score: 121.3 bits (303), Expect = 1.2e-24 Identity = 57/57 (100.00%), Postives = 57/57 (100.00%), Query Frame = 2
BLAST of CU089582 vs. NCBI nr
Match: gi|778657072|ref|XP_011650222.1| (PREDICTED: uncharacterized protein LOC101203219 isoform X1 [Cucumis sativus]) HSP 1 Score: 110.5 bits (275), Expect = 2.1e-21 Identity = 50/53 (94.34%), Postives = 50/53 (94.34%), Query Frame = 3
BLAST of CU089582 vs. NCBI nr
Match: gi|659066589|ref|XP_008451628.1| (PREDICTED: uncharacterized protein LOC103492827 isoform X1 [Cucumis melo]) HSP 1 Score: 101.3 bits (251), Expect = 1.2e-18 Identity = 46/53 (86.79%), Postives = 47/53 (88.68%), Query Frame = 3
BLAST of CU089582 vs. NCBI nr
Match: gi|698498519|ref|XP_009795161.1| (PREDICTED: uncharacterized protein LOC104241897 isoform X2 [Nicotiana sylvestris]) HSP 1 Score: 96.3 bits (238), Expect = 4.0e-17 Identity = 43/54 (79.63%), Postives = 48/54 (88.89%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|