CU088343 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CGGCCGGGGACTCCGAGCTAGTCTTAAAGTAATCTTGATTCATAGGATACGTTATCCTCCGAAGATTTCTTCTAGGTGAGTTTGCGGATTTGCTTGTGTATAACCGATGGGTTTGAGGGCGGTGTACTGATGTCATTGTTCTGGATTGTGATTCGTCAATTTGCAGAGAACGTAAGCGATGGCCGCGTCAATGAAAGTCATTACAAGGGAAGAGTGGGAGAAGAAGCTTAACGACGTAAAGATTAGGAAAGAAGACATGAATAAATTGGTAATGAATTTCCTCGTCACTGAAGGTTATGTTGATGCAGCCGAGAAATTCCGGATGGAGTCTGGGGACTAGAAGAACCAAAGAAAAATAAAGAAATAACTTAGACAACCATAACAGATAGAATGGCCGTTA
BLAST of CU088343 vs. Swiss-Prot
Match: GID8_DANRE (Glucose-induced degradation protein 8 homolog OS=Danio rerio GN=gid8 PE=2 SV=1) HSP 1 Score: 70.1 bits (170), Expect = 2.1e-11 Identity = 31/45 (68.89%), Postives = 38/45 (84.44%), Query Frame = 2
BLAST of CU088343 vs. Swiss-Prot
Match: GID8_CHICK (Glucose-induced degradation protein 8 homolog OS=Gallus gallus GN=GID8 PE=2 SV=1) HSP 1 Score: 68.6 bits (166), Expect = 6.1e-11 Identity = 29/45 (64.44%), Postives = 39/45 (86.67%), Query Frame = 2
BLAST of CU088343 vs. Swiss-Prot
Match: GID8_BOVIN (Glucose-induced degradation protein 8 homolog OS=Bos taurus GN=GID8 PE=2 SV=1) HSP 1 Score: 68.2 bits (165), Expect = 7.9e-11 Identity = 28/45 (62.22%), Postives = 39/45 (86.67%), Query Frame = 2
BLAST of CU088343 vs. Swiss-Prot
Match: GID8_HUMAN (Glucose-induced degradation protein 8 homolog OS=Homo sapiens GN=GID8 PE=1 SV=1) HSP 1 Score: 68.2 bits (165), Expect = 7.9e-11 Identity = 28/45 (62.22%), Postives = 39/45 (86.67%), Query Frame = 2
BLAST of CU088343 vs. Swiss-Prot
Match: GID8_MOUSE (Glucose-induced degradation protein 8 homolog OS=Mus musculus GN=Gid8 PE=1 SV=1) HSP 1 Score: 68.2 bits (165), Expect = 7.9e-11 Identity = 28/45 (62.22%), Postives = 39/45 (86.67%), Query Frame = 2
BLAST of CU088343 vs. TrEMBL
Match: A0A0A0LV19_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G073020 PE=4 SV=1) HSP 1 Score: 103.2 bits (256), Expect = 2.5e-19 Identity = 51/53 (96.23%), Postives = 51/53 (96.23%), Query Frame = 2
BLAST of CU088343 vs. TrEMBL
Match: A0A0A0LV19_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G073020 PE=4 SV=1) HSP 1 Score: 32.7 bits (73), Expect = 4.1e+02 Identity = 14/14 (100.00%), Postives = 14/14 (100.00%), Query Frame = 1
HSP 2 Score: 102.8 bits (255), Expect = 3.2e-19 Identity = 51/53 (96.23%), Postives = 51/53 (96.23%), Query Frame = 2
BLAST of CU088343 vs. TrEMBL
Match: A0A067GKH7_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g026151mg PE=4 SV=1) HSP 1 Score: 102.8 bits (255), Expect = 3.2e-19 Identity = 51/53 (96.23%), Postives = 51/53 (96.23%), Query Frame = 2
BLAST of CU088343 vs. TrEMBL
Match: A0A067GKH3_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g026151mg PE=4 SV=1) HSP 1 Score: 102.8 bits (255), Expect = 3.2e-19 Identity = 51/53 (96.23%), Postives = 51/53 (96.23%), Query Frame = 2
BLAST of CU088343 vs. TrEMBL
Match: V4TPR8_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10016453mg PE=4 SV=1) HSP 1 Score: 102.8 bits (255), Expect = 3.2e-19 Identity = 51/53 (96.23%), Postives = 51/53 (96.23%), Query Frame = 2
BLAST of CU088343 vs. NCBI nr
Match: gi|449457706|ref|XP_004146589.1| (PREDICTED: glucose-induced degradation protein 8 homolog [Cucumis sativus]) HSP 1 Score: 104.0 bits (258), Expect = 2.1e-19 Identity = 51/53 (96.23%), Postives = 51/53 (96.23%), Query Frame = 2
BLAST of CU088343 vs. NCBI nr
Match: gi|802783197|ref|XP_012091544.1| (PREDICTED: glucose-induced degradation protein 8 homolog isoform X2 [Jatropha curcas]) HSP 1 Score: 104.0 bits (258), Expect = 2.1e-19 Identity = 51/53 (96.23%), Postives = 51/53 (96.23%), Query Frame = 2
BLAST of CU088343 vs. NCBI nr
Match: gi|743899901|ref|XP_011043244.1| (PREDICTED: glucose-induced degradation protein 8 homolog [Populus euphratica]) HSP 1 Score: 104.0 bits (258), Expect = 2.1e-19 Identity = 51/53 (96.23%), Postives = 52/53 (98.11%), Query Frame = 2
BLAST of CU088343 vs. NCBI nr
Match: gi|659067987|ref|XP_008442205.1| (PREDICTED: glucose-induced degradation protein 8 homolog isoform X2 [Cucumis melo]) HSP 1 Score: 104.0 bits (258), Expect = 2.1e-19 Identity = 51/53 (96.23%), Postives = 51/53 (96.23%), Query Frame = 2
BLAST of CU088343 vs. NCBI nr
Match: gi|802783193|ref|XP_012091543.1| (PREDICTED: glucose-induced degradation protein 8 homolog isoform X1 [Jatropha curcas]) HSP 1 Score: 104.0 bits (258), Expect = 2.1e-19 Identity = 51/53 (96.23%), Postives = 51/53 (96.23%), Query Frame = 2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|