CU087937 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GGCCCAGCTTTCCATCTTAGTCTACCCAACAACACTACTCTCAACCCTAAAACTCCAATTGTTTGATCCGTTACCAACCCATTTGCCACCTCCAACGACACTGCCACCGCCCCACCGCCTAGTACTGGAGAACAATCGCAACTGTGCTCCGCTTTTCGTGAGCCAGCGGAGGCAATATCACCTGCGACGTTATCTGCTGGTTCCTATACGACACAAAGACAGTCAGTCTGTCGTAATAAATGGAAACTCGCCTGTTGGGGTTCCTCGTAACGATTGTGAATTGCATGGTTGTAGACAGCAGCGGAAGAG
BLAST of CU087937 vs. Swiss-Prot
Match: NHL12_ARATH (NDR1/HIN1-like protein 12 OS=Arabidopsis thaliana GN=NHL12 PE=2 SV=1) HSP 1 Score: 57.4 bits (137), Expect = 1.1e-07 Identity = 25/45 (55.56%), Postives = 31/45 (68.89%), Query Frame = -3
BLAST of CU087937 vs. TrEMBL
Match: A0A0A0L882_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G116630 PE=4 SV=1) HSP 1 Score: 114.8 bits (286), Expect = 6.3e-23 Identity = 57/58 (98.28%), Postives = 58/58 (100.00%), Query Frame = -3
BLAST of CU087937 vs. TrEMBL
Match: A0A0A0L882_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G116630 PE=4 SV=1) HSP 1 Score: 55.1 bits (131), Expect = 5.9e-05 Identity = 29/43 (67.44%), Postives = 29/43 (67.44%), Query Frame = -2
HSP 2 Score: 92.0 bits (227), Expect = 4.4e-16 Identity = 44/57 (77.19%), Postives = 48/57 (84.21%), Query Frame = -3
BLAST of CU087937 vs. TrEMBL
Match: M5X269_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa011309mg PE=4 SV=1) HSP 1 Score: 39.7 bits (91), Expect = 2.6e+00 Identity = 21/43 (48.84%), Postives = 22/43 (51.16%), Query Frame = -2
HSP 2 Score: 91.3 bits (225), Expect = 7.5e-16 Identity = 43/57 (75.44%), Postives = 48/57 (84.21%), Query Frame = -3
BLAST of CU087937 vs. TrEMBL
Match: F6I2Y6_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_15s0048g02530 PE=4 SV=1) HSP 1 Score: 42.7 bits (99), Expect = 3.0e-01 Identity = 23/43 (53.49%), Postives = 24/43 (55.81%), Query Frame = -2
HSP 2 Score: 91.3 bits (225), Expect = 7.5e-16 Identity = 43/57 (75.44%), Postives = 48/57 (84.21%), Query Frame = -3
BLAST of CU087937 vs. TrEMBL
Match: A5BJJ5_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VITISV_027904 PE=4 SV=1) HSP 1 Score: 42.7 bits (99), Expect = 3.0e-01 Identity = 23/43 (53.49%), Postives = 24/43 (55.81%), Query Frame = -2
HSP 2 Score: 89.0 bits (219), Expect = 3.7e-15 Identity = 42/57 (73.68%), Postives = 48/57 (84.21%), Query Frame = -3
BLAST of CU087937 vs. NCBI nr
Match: gi|449431934|ref|XP_004133755.1| (PREDICTED: protein YLS9-like [Cucumis sativus]) HSP 1 Score: 113.2 bits (282), Expect = 2.6e-22 Identity = 57/58 (98.28%), Postives = 58/58 (100.00%), Query Frame = -3
BLAST of CU087937 vs. NCBI nr
Match: gi|659074695|ref|XP_008437747.1| (PREDICTED: protein YLS9-like [Cucumis melo]) HSP 1 Score: 112.8 bits (281), Expect = 3.4e-22 Identity = 56/58 (96.55%), Postives = 58/58 (100.00%), Query Frame = -3
BLAST of CU087937 vs. NCBI nr
Match: gi|1009142786|ref|XP_015888911.1| (PREDICTED: protein YLS9 isoform X2 [Ziziphus jujuba]) HSP 1 Score: 96.7 bits (239), Expect = 2.5e-17 Identity = 46/57 (80.70%), Postives = 52/57 (91.23%), Query Frame = -3
BLAST of CU087937 vs. NCBI nr
Match: gi|1009142781|ref|XP_015888908.1| (PREDICTED: protein YLS9 isoform X1 [Ziziphus jujuba]) HSP 1 Score: 96.7 bits (239), Expect = 2.5e-17 Identity = 46/57 (80.70%), Postives = 52/57 (91.23%), Query Frame = -3
BLAST of CU087937 vs. NCBI nr
Match: gi|694380987|ref|XP_009366593.1| (PREDICTED: protein YLS9 [Pyrus x bretschneideri]) HSP 1 Score: 96.3 bits (238), Expect = 3.3e-17 Identity = 46/57 (80.70%), Postives = 51/57 (89.47%), Query Frame = -3
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|