|
|
The following sequences are available for this feature:
transcribed_cluster sequence GAAAATAAACATTCTCCTCACAGTAGAAAGGAGTATGGCGGAACTGGGAAACATCCAAATCACTCGATTCTACCGTTGATGTTGTTGAAGCCATGGCTTAATCTAATCGGCTAGTTGAGTTCCTTCAGATTCTAGAAAAGAGCATGCACTTTCGAAAAGTTTTTGGTTAGTTTGATCGTATTGAAAAACAAGCATTTGAATATAAAAATGGAACAAATTCAAACTATAGGGTTCAAAATGATATTTTAATTTTTCTCCCTTCTAGTTCTAATTTGGTGCCCACTAAGGATTCAAACGTCTACTACACATAGCAACAATTTATCTGAGATTATAGAGTTTGTTTGTGAGAGTTTATTCATGATTTCACCAAAACTTTGATGATGACTTACATTATGTCTCCCGGC
The following BLAST results are available for this feature:
| Match Name | E-value | Identity | Description | |
|---|
The following terms have been associated with this transcribed_cluster:
Vocabulary: INTERPRO
| Term | Definition |
|---|
| IPR023128 | Prot_N_Gln_amidohydro_ab_roll |
Vocabulary: Molecular Function
| Term | Definition |
|---|
| GO:0016811 | hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amides |
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
| Category |
Term Accession |
Term Name |
| molecular_function |
GO:0016811 |
hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amides |
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
| IPR Term | IPR Description | Source | Source Term | Source Description | Alignment |
|---|
| IPR023128 | Protein N-terminal glutamine amidohydrolase, alpha beta roll | GENE3D | G3DSA:3.10.620.10 | | coord: 6..30
score: 8. |
|
