CU087134 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GAGAAAAGAAGTATGGAAAGTCAGAATAAACAACACGAGAAGAAGAATCTCAAGCAAGCCAATGTCTTTACAGACTTGCTTTCTTCTTCTTCTCTTTCTCTTCCTCTTCCTCTTCCTCTTTCAAGATCTTTGTCTAGTTCGAGGAGATGTTGATGGAGTCAGAGATAACTCGAAGGTTTCTCGAACAACAAAAGAAATACATCTCTATTGGAGCTTTAAAGAAGGATCACCCTGCTTGCGATGGCGCTAGT
BLAST of CU087134 vs. TrEMBL
Match: A0A0A0L9A8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G171840 PE=4 SV=1) HSP 1 Score: 77.4 bits (189), Expect = 9.1e-12 Identity = 37/37 (100.00%), Postives = 37/37 (100.00%), Query Frame = 3
BLAST of CU087134 vs. TrEMBL
Match: A0A0A0L9A8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G171840 PE=4 SV=1) HSP 1 Score: 42.0 bits (97), Expect = 4.2e-01 Identity = 23/38 (60.53%), Postives = 24/38 (63.16%), Query Frame = 2
HSP 2 Score: 60.8 bits (146), Expect = 8.8e-07 Identity = 32/38 (84.21%), Postives = 32/38 (84.21%), Query Frame = 3
BLAST of CU087134 vs. NCBI nr
Match: gi|778679218|ref|XP_004147646.2| (PREDICTED: protein RALF-like 32 [Cucumis sativus]) HSP 1 Score: 77.8 bits (190), Expect = 1.0e-11 Identity = 37/37 (100.00%), Postives = 37/37 (100.00%), Query Frame = 3
BLAST of CU087134 vs. NCBI nr
Match: gi|659077106|ref|XP_008439036.1| (PREDICTED: protein RALF-like 32 [Cucumis melo]) HSP 1 Score: 71.2 bits (173), Expect = 9.3e-10 Identity = 33/37 (89.19%), Postives = 36/37 (97.30%), Query Frame = 3
BLAST of CU087134 vs. NCBI nr
Match: gi|700202095|gb|KGN57228.1| (hypothetical protein Csa_3G171850 [Cucumis sativus]) HSP 1 Score: 61.2 bits (147), Expect = 9.6e-07 Identity = 32/38 (84.21%), Postives = 32/38 (84.21%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|