CU087007 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AAGTAGTTGCCATTTCTGAATTAGAGAAAGTAGTTTTTCGGTAGATCAGATTAGCGCCCTGAAGTGAGAACTTGGATAAAGAAAACTGGCTGGATGGTGCAGTGAACTGGTGAGAGTAGGAAATTGTTGGTACAATGCCGCCGAAACTCCAAAACTCCGACGCCGGAGAAAGCAAAAGGAAAAGAAAGACTTGAAGAATTTAATTAAAAGTCCCCG
BLAST of CU087007 vs. TrEMBL
Match: A0A0A0L713_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G200190 PE=4 SV=1) HSP 1 Score: 70.9 bits (172), Expect = 7.3e-10 Identity = 31/32 (96.88%), Postives = 32/32 (100.00%), Query Frame = -2
BLAST of CU087007 vs. NCBI nr
Match: gi|700202375|gb|KGN57508.1| (hypothetical protein Csa_3G200190 [Cucumis sativus]) HSP 1 Score: 72.4 bits (176), Expect = 3.6e-10 Identity = 31/32 (96.88%), Postives = 32/32 (100.00%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|