CU086925 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
GAAAAGAAGAAGTTAAGCGGAGAAAGAAGAAAGAAGATCGATCTCCGTGGAACGAAGGACGGCGAGGAAGCTGAAGAGGGCGGCGAAAGCAACAGCAAGAAGACCTCTTTCTTTAACGATTACGGAGGCCAAGTACATGGCTACATCGGCGGTGATCTTTCTCCCATCTTTGACCAGAACTCGCCGTCAGTTCCCGGCGAACGCCAATAGCACCAACACCGTAATCCACGCCACCATCGTGGCT
BLAST of CU086925 vs. TrEMBL
Match: A0A0A0LNT4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G003480 PE=4 SV=1) HSP 1 Score: 93.2 bits (230), Expect = 1.6e-16 Identity = 52/69 (75.36%), Postives = 52/69 (75.36%), Query Frame = -2
BLAST of CU086925 vs. TrEMBL
Match: A0A0A0LRZ2_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G003500 PE=4 SV=1) HSP 1 Score: 90.9 bits (224), Expect = 7.7e-16 Identity = 51/68 (75.00%), Postives = 51/68 (75.00%), Query Frame = -2
BLAST of CU086925 vs. TrEMBL
Match: W9S826_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_002064 PE=4 SV=1) HSP 1 Score: 71.2 bits (173), Expect = 6.3e-10 Identity = 36/45 (80.00%), Postives = 39/45 (86.67%), Query Frame = -2
BLAST of CU086925 vs. TrEMBL
Match: A0A068UYP2_COFCA (Uncharacterized protein OS=Coffea canephora GN=GSCOC_T00037351001 PE=4 SV=1) HSP 1 Score: 70.9 bits (172), Expect = 8.3e-10 Identity = 35/46 (76.09%), Postives = 40/46 (86.96%), Query Frame = -2
BLAST of CU086925 vs. TrEMBL
Match: M5VW42_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa026311mg PE=4 SV=1) HSP 1 Score: 69.3 bits (168), Expect = 2.4e-09 Identity = 35/46 (76.09%), Postives = 40/46 (86.96%), Query Frame = -2
BLAST of CU086925 vs. NCBI nr
Match: gi|700208434|gb|KGN63530.1| (hypothetical protein Csa_1G003480 [Cucumis sativus]) HSP 1 Score: 92.8 bits (229), Expect = 2.9e-16 Identity = 52/69 (75.36%), Postives = 52/69 (75.36%), Query Frame = -2
BLAST of CU086925 vs. NCBI nr
Match: gi|700208436|gb|KGN63532.1| (hypothetical protein Csa_1G003500 [Cucumis sativus]) HSP 1 Score: 90.5 bits (223), Expect = 1.4e-15 Identity = 51/68 (75.00%), Postives = 51/68 (75.00%), Query Frame = -2
BLAST of CU086925 vs. NCBI nr
Match: gi|659129057|ref|XP_008464506.1| (PREDICTED: uncharacterized protein LOC103502369 [Cucumis melo]) HSP 1 Score: 89.0 bits (219), Expect = 4.2e-15 Identity = 50/69 (72.46%), Postives = 51/69 (73.91%), Query Frame = -2
BLAST of CU086925 vs. NCBI nr
Match: gi|645264763|ref|XP_008237833.1| (PREDICTED: uncharacterized protein LOC103336555 [Prunus mume]) HSP 1 Score: 70.5 bits (171), Expect = 1.6e-09 Identity = 36/47 (76.60%), Postives = 41/47 (87.23%), Query Frame = -2
BLAST of CU086925 vs. NCBI nr
Match: gi|703122937|ref|XP_010102690.1| (hypothetical protein L484_002064 [Morus notabilis]) HSP 1 Score: 70.5 bits (171), Expect = 1.6e-09 Identity = 36/45 (80.00%), Postives = 39/45 (86.67%), Query Frame = -2
The following BLAST results are available for this feature:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
|