CU086020 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
CCGGGGATTTCTCTTCTTTTTCTCTTTCTTCTTTGTCCTTGCCTCTTCTTCTTCTTCACCCACTTTCTCTATTTTCTTCCCTACTTCTTCATTACCCATCTTCCTTTCTCTCCTTCTTTCCCATTCATCTAACTTTTTCCCTCTTTTCCCTTCTGGGTTTTTGTTTTCTTTCCTTCCTTCTCATCTATGAAGAAGATGAAGGGAGTTGTCTCTCAATACCCTGTTTACGAGGATTCCAAGACTAGATTCAAGCGTCAGAGTCTCCTCCAAGATTATCGTGACTTGGAGAAGGAAACAGGGACTGTCAAGAGGAAATTACAAATGATGAAGCAAAAGAAG
BLAST of CU086020 vs. TrEMBL
Match: A0A0A0LW13_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G256780 PE=4 SV=1) HSP 1 Score: 100.1 bits (248), Expect = 1.8e-18 Identity = 49/51 (96.08%), Postives = 49/51 (96.08%), Query Frame = 1
BLAST of CU086020 vs. TrEMBL
Match: A0A0B0NU00_GOSAR (Ribosomal RNA small subunit methyltransferase G OS=Gossypium arboreum GN=F383_10342 PE=4 SV=1) HSP 1 Score: 70.1 bits (170), Expect = 2.0e-09 Identity = 34/56 (60.71%), Postives = 42/56 (75.00%), Query Frame = 1
BLAST of CU086020 vs. TrEMBL
Match: A0A0D2QK29_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_001G032800 PE=4 SV=1) HSP 1 Score: 69.7 bits (169), Expect = 2.6e-09 Identity = 34/56 (60.71%), Postives = 42/56 (75.00%), Query Frame = 1
BLAST of CU086020 vs. TrEMBL
Match: A0A0D2PU39_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_001G032800 PE=4 SV=1) HSP 1 Score: 69.7 bits (169), Expect = 2.6e-09 Identity = 34/56 (60.71%), Postives = 42/56 (75.00%), Query Frame = 1
BLAST of CU086020 vs. TrEMBL
Match: M5VX06_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa013045mg PE=4 SV=1) HSP 1 Score: 68.6 bits (166), Expect = 5.7e-09 Identity = 34/55 (61.82%), Postives = 42/55 (76.36%), Query Frame = 1
BLAST of CU086020 vs. NCBI nr
Match: gi|700210073|gb|KGN65169.1| (hypothetical protein Csa_1G256780 [Cucumis sativus]) HSP 1 Score: 94.0 bits (232), Expect = 1.8e-16 Identity = 49/51 (96.08%), Postives = 49/51 (96.08%), Query Frame = 1
BLAST of CU086020 vs. NCBI nr
Match: gi|659086278|ref|XP_008443848.1| (PREDICTED: uncharacterized protein LOC103487344 [Cucumis melo]) HSP 1 Score: 94.0 bits (232), Expect = 1.8e-16 Identity = 49/51 (96.08%), Postives = 49/51 (96.08%), Query Frame = 1
BLAST of CU086020 vs. NCBI nr
Match: gi|778665044|ref|XP_011648472.1| (PREDICTED: uncharacterized protein LOC101209712 [Cucumis sativus]) HSP 1 Score: 94.0 bits (232), Expect = 1.8e-16 Identity = 49/51 (96.08%), Postives = 49/51 (96.08%), Query Frame = 1
BLAST of CU086020 vs. NCBI nr
Match: gi|728835133|gb|KHG14576.1| (Ribosomal RNA small subunit methyltransferase G [Gossypium arboreum]) HSP 1 Score: 63.9 bits (154), Expect = 2.0e-07 Identity = 34/56 (60.71%), Postives = 42/56 (75.00%), Query Frame = 1
BLAST of CU086020 vs. NCBI nr
Match: gi|823120909|ref|XP_012444344.1| (PREDICTED: uncharacterized protein LOC105768726 [Gossypium raimondii]) HSP 1 Score: 63.5 bits (153), Expect = 2.6e-07 Identity = 34/56 (60.71%), Postives = 42/56 (75.00%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|