MELO3C029080.2.1 (mRNA) Melon (DHL92) v3.6.1
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGGAGAAAGATCGAAATGGTATCCTTTTGGAGTCATTCTCTTTCCCCAAAGAAGAACTAGTTCACTTGTCATTGCATGAAAGCACTCACCCAACAGCTTGTAATTATGGCAACGATCCGTACGATGATATTGATGTGAAGGAGACTTTGAATCAACTACCAAGGGAGATTCTTAATATGCGCAATCAACTTCTGAAGCAGGCCATGAACCTTCCGTGA ATGGAGAAAGATCGAAATGGTATCCTTTTGGAGTCATTCTCTTTCCCCAAAGAAGAACTAGTTCACTTGTCATTGCATGAAAGCACTCACCCAACAGCTTGTAATTATGGCAACGATCCGTACGATGATATTGATGTGAAGGAGACTTTGAATCAACTACCAAGGGAGATTCTTAATATGCGCAATCAACTTCTGAAGCAGGCCATGAACCTTCCGTGA ATGGAGAAAGATCGAAATGGTATCCTTTTGGAGTCATTCTCTTTCCCCAAAGAAGAACTAGTTCACTTGTCATTGCATGAAAGCACTCACCCAACAGCTTGTAATTATGGCAACGATCCGTACGATGATATTGATGTGAAGGAGACTTTGAATCAACTACCAAGGGAGATTCTTAATATGCGCAATCAACTTCTGAAGCAGGCCATGAACCTTCCGTGA MEKDRNGILLESFSFPKEELVHLSLHESTHPTACNYGNDPYDDIDVKETLNQLPREILNMRNQLLKQAMNLP
BLAST of MELO3C029080.2.1 vs. NCBI nr
Match: XP_012465033.1 (PREDICTED: cytochrome b-c1 complex subunit 7-2 isoform X2 [Gossypium raimondii] >KJB80690.1 hypothetical protein B456_013G110700 [Gossypium raimondii]) HSP 1 Score: 53.1 bits (126), Expect = 4.4e-04 Identity = 31/68 (45.59%), Postives = 41/68 (60.29%), Query Frame = 0
BLAST of MELO3C029080.2.1 vs. NCBI nr
Match: KJB80691.1 (hypothetical protein B456_013G110700 [Gossypium raimondii]) HSP 1 Score: 53.1 bits (126), Expect = 4.4e-04 Identity = 31/68 (45.59%), Postives = 41/68 (60.29%), Query Frame = 0
BLAST of MELO3C029080.2.1 vs. NCBI nr
Match: XP_012465032.1 (PREDICTED: cytochrome b-c1 complex subunit 7-2 isoform X1 [Gossypium raimondii] >KJB80692.1 hypothetical protein B456_013G110700 [Gossypium raimondii]) HSP 1 Score: 53.1 bits (126), Expect = 4.4e-04 Identity = 31/68 (45.59%), Postives = 41/68 (60.29%), Query Frame = 0
BLAST of MELO3C029080.2.1 vs. NCBI nr
Match: XP_022937393.1 (cytochrome b-c1 complex subunit 7-2-like [Cucurbita moschata] >XP_023535588.1 cytochrome b-c1 complex subunit 7-2-like [Cucurbita pepo subsp. pepo] >XP_023535589.1 cytochrome b-c1 complex subunit 7-2-like [Cucurbita pepo subsp. pepo]) HSP 1 Score: 52.8 bits (125), Expect = 5.8e-04 Identity = 32/68 (47.06%), Postives = 41/68 (60.29%), Query Frame = 0
BLAST of MELO3C029080.2.1 vs. NCBI nr
Match: XP_022976218.1 (cytochrome b-c1 complex subunit 7-2-like [Cucurbita maxima]) HSP 1 Score: 52.8 bits (125), Expect = 5.8e-04 Identity = 32/68 (47.06%), Postives = 41/68 (60.29%), Query Frame = 0
BLAST of MELO3C029080.2.1 vs. TAIR10
Match: AT4G32470.1 (Cytochrome bd ubiquinol oxidase, 14kDa subunit) HSP 1 Score: 43.9 bits (102), Expect = 4.9e-05 Identity = 25/69 (36.23%), Postives = 40/69 (57.97%), Query Frame = 0
BLAST of MELO3C029080.2.1 vs. TAIR10
Match: AT5G25450.1 (Cytochrome bd ubiquinol oxidase, 14kDa subunit) HSP 1 Score: 43.5 bits (101), Expect = 6.4e-05 Identity = 20/33 (60.61%), Postives = 27/33 (81.82%), Query Frame = 0
BLAST of MELO3C029080.2.1 vs. Swiss-Prot
Match: sp|Q9SUU5|QCR71_ARATH (Cytochrome b-c1 complex subunit 7-1 OS=Arabidopsis thaliana OX=3702 GN=QCR7-1 PE=1 SV=1) HSP 1 Score: 43.9 bits (102), Expect = 8.8e-04 Identity = 25/69 (36.23%), Postives = 40/69 (57.97%), Query Frame = 0
BLAST of MELO3C029080.2.1 vs. TrEMBL
Match: tr|A0A0D2VC65|A0A0D2VC65_GOSRA (Cytochrome b-c1 complex subunit 7 OS=Gossypium raimondii OX=29730 GN=B456_013G110700 PE=3 SV=1) HSP 1 Score: 53.1 bits (126), Expect = 2.9e-04 Identity = 31/68 (45.59%), Postives = 41/68 (60.29%), Query Frame = 0
BLAST of MELO3C029080.2.1 vs. TrEMBL
Match: tr|A0A0D2W4Y1|A0A0D2W4Y1_GOSRA (Cytochrome b-c1 complex subunit 7 OS=Gossypium raimondii OX=29730 GN=B456_013G110700 PE=3 SV=1) HSP 1 Score: 53.1 bits (126), Expect = 2.9e-04 Identity = 31/68 (45.59%), Postives = 41/68 (60.29%), Query Frame = 0
BLAST of MELO3C029080.2.1 vs. TrEMBL
Match: tr|A0A0D2SC48|A0A0D2SC48_GOSRA (Uncharacterized protein OS=Gossypium raimondii OX=29730 GN=B456_013G110700 PE=4 SV=1) HSP 1 Score: 53.1 bits (126), Expect = 2.9e-04 Identity = 31/68 (45.59%), Postives = 41/68 (60.29%), Query Frame = 0
BLAST of MELO3C029080.2.1 vs. TrEMBL
Match: tr|A0A2N9ISI5|A0A2N9ISI5_FAGSY (Cytochrome b-c1 complex subunit 7 OS=Fagus sylvatica OX=28930 GN=FSB_LOCUS54985 PE=3 SV=1) HSP 1 Score: 51.6 bits (122), Expect = 8.5e-04 Identity = 31/68 (45.59%), Postives = 40/68 (58.82%), Query Frame = 0
The following BLAST results are available for this feature:
The following terms have been associated with this mRNA:
GO Assignments
This mRNA is annotated with the following GO terms.
This mRNA is a part of the following gene feature(s):
The following CDS feature(s) are a part of this mRNA:
The following exon feature(s) are a part of this mRNA:
The following polypeptide feature(s) derives from this mRNA:
Analysis Name: InterPro Annotations of melon v3.6.1
Date Performed: 2018-09-25
|