Cucsa.012670.1 (mRNA) Cucumber (Gy14) v1
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATCCTCAAAATCCGGACGCTGAGATCAAATGTGGATCATGCCCTTGTTCCAATCCATGTATTCAACAACTATCGCCACCACCGCCGCCTCCGCCTCCTCCTCCTCCTTCTCCTTGTGCTCCAACGGTGTCCTCTCGACCACCACCTCCTAGGTTTATTTATACTACGTCATCACCTGCACCACCACCTCCAAGGTTTACTTATACGACGGGTGTTCCCGGTAATTTGTACGAGATTGATGCGAATAATAGTTGGTATTACTTCTCTGGCACGAGGAGGACGCGGCCGGGCATGGCGGCAGTTGTGGTGGCGATTGGCTGTGGAGCTTTGCATCTAATGGGGTTTAGTAAGTGGTGA ATCCTCAAAATCCGGACGCTGAGATCAAATGTGGATCATGCCCTTGTTCCAATCCATGTATTCAACAACTATCGCCACCACCGCCGcctccgcctcctcctcctccttctcctTGTGCTCCAACGGTGTCCTCTCGACCACCACCTCCTAGGTTTATTTATACTACGTCATCACCTGCACCACCACCTCCAAGGTTTACTTATACGACGGGTGTTCCCGGTAATTTGTACGAGATTGATGCGAATAATAGTTGGTATTACTTCTCTGGCACGAGGAGGACGCGGCCGGGCATGGCGGCAGTTGTGGTGGCGATTGGCTGTGGAGCTTTGCATCTAATGGGGTTTAGTAAGTGGTGA ATCCTCAAAATCCGGACGCTGAGATCAAATGTGGATCATGCCCTTGTTCCAATCCATGTATTCAACAACTATCGCCACCACCGCCGCCTCCGCCTCCTCCTCCTCCTTCTCCTTGTGCTCCAACGGTGTCCTCTCGACCACCACCTCCTAGGTTTATTTATACTACGTCATCACCTGCACCACCACCTCCAAGGTTTACTTATACGACGGGTGTTCCCGGTAATTTGTACGAGATTGATGCGAATAATAGTTGGTATTACTTCTCTGGCACGAGGAGGACGCGGCCGGGCATGGCGGCAGTTGTGGTGGCGATTGGCTGTGGAGCTTTGCATCTAATGGGGTTTAGTAAGTGGTGA PQNPDAEIKCGSCPCSNPCIQQLSPPPPPPPPPPPSPCAPTVSSRPPPPRFIYTTSSPAPPPPRFTYTTGVPGNLYEIDANNSWYYFSGTRRTRPGMAAVVVAIGCGALHLMGFSKW*
BLAST of Cucsa.012670.1 vs. Swiss-Prot
Match: LRX6_ARATH (Leucine-rich repeat extensin-like protein 6 OS=Arabidopsis thaliana GN=LRX6 PE=2 SV=1) HSP 1 Score: 67.4 bits (163), Expect = 1.2e-10 Identity = 32/70 (45.71%), Postives = 37/70 (52.86%), Query Frame = 1
HSP 2 Score: 50.8 bits (120), Expect = 1.2e-05 Identity = 24/56 (42.86%), Postives = 27/56 (48.21%), Query Frame = 1
BLAST of Cucsa.012670.1 vs. Swiss-Prot
Match: LRX3_ARATH (Leucine-rich repeat extensin-like protein 3 OS=Arabidopsis thaliana GN=LRX3 PE=1 SV=1) HSP 1 Score: 59.3 bits (142), Expect = 3.3e-08 Identity = 23/39 (58.97%), Postives = 26/39 (66.67%), Query Frame = 1
HSP 2 Score: 57.4 bits (137), Expect = 1.2e-07 Identity = 26/63 (41.27%), Postives = 31/63 (49.21%), Query Frame = 1
HSP 3 Score: 56.2 bits (134), Expect = 2.8e-07 Identity = 25/50 (50.00%), Postives = 29/50 (58.00%), Query Frame = 1
HSP 4 Score: 53.1 bits (126), Expect = 2.3e-06 Identity = 30/66 (45.45%), Postives = 35/66 (53.03%), Query Frame = 1
HSP 5 Score: 52.0 bits (123), Expect = 5.2e-06 Identity = 31/80 (38.75%), Postives = 37/80 (46.25%), Query Frame = 1
HSP 6 Score: 43.1 bits (100), Expect = 2.4e-03 Identity = 24/60 (40.00%), Postives = 28/60 (46.67%), Query Frame = 1
BLAST of Cucsa.012670.1 vs. Swiss-Prot
Match: LECT_SOLTU (Chitin-binding lectin 1 OS=Solanum tuberosum PE=1 SV=2) HSP 1 Score: 58.2 bits (139), Expect = 7.3e-08 Identity = 27/55 (49.09%), Postives = 31/55 (56.36%), Query Frame = 1
HSP 2 Score: 56.2 bits (134), Expect = 2.8e-07 Identity = 29/55 (52.73%), Postives = 31/55 (56.36%), Query Frame = 1
BLAST of Cucsa.012670.1 vs. Swiss-Prot
Match: FH3_ORYSJ (Formin-like protein 3 OS=Oryza sativa subsp. japonica GN=FH3 PE=2 SV=2) HSP 1 Score: 56.6 bits (135), Expect = 2.1e-07 Identity = 26/55 (47.27%), Postives = 30/55 (54.55%), Query Frame = 1
HSP 2 Score: 55.8 bits (133), Expect = 3.6e-07 Identity = 30/79 (37.97%), Postives = 36/79 (45.57%), Query Frame = 1
HSP 3 Score: 53.5 bits (127), Expect = 1.8e-06 Identity = 25/50 (50.00%), Postives = 28/50 (56.00%), Query Frame = 1
HSP 4 Score: 45.4 bits (106), Expect = 4.9e-04 Identity = 22/38 (57.89%), Postives = 22/38 (57.89%), Query Frame = 1
HSP 5 Score: 45.4 bits (106), Expect = 4.9e-04 Identity = 21/43 (48.84%), Postives = 23/43 (53.49%), Query Frame = 1
HSP 6 Score: 43.5 bits (101), Expect = 1.9e-03 Identity = 23/63 (36.51%), Postives = 27/63 (42.86%), Query Frame = 1
HSP 7 Score: 33.1 bits (74), Expect = 2.5e+00 Identity = 24/68 (35.29%), Postives = 25/68 (36.76%), Query Frame = 1
BLAST of Cucsa.012670.1 vs. Swiss-Prot
Match: VP61_NPVAC (61 kDa protein OS=Autographa californica nuclear polyhedrosis virus GN=P61 PE=3 SV=2) HSP 1 Score: 56.6 bits (135), Expect = 2.1e-07 Identity = 25/43 (58.14%), Postives = 28/43 (65.12%), Query Frame = 1
BLAST of Cucsa.012670.1 vs. TrEMBL
Match: A0A0A0L7R0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G346900 PE=4 SV=1) HSP 1 Score: 257.3 bits (656), Expect = 9.1e-66 Identity = 115/118 (97.46%), Postives = 115/118 (97.46%), Query Frame = 1
BLAST of Cucsa.012670.1 vs. TrEMBL
Match: U5FGW6_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0017s03030g PE=4 SV=1) HSP 1 Score: 119.4 bits (298), Expect = 3.0e-24 Identity = 60/116 (51.72%), Postives = 69/116 (59.48%), Query Frame = 1
BLAST of Cucsa.012670.1 vs. TrEMBL
Match: A0A061EG52_THECC (Uncharacterized protein OS=Theobroma cacao GN=TCM_019232 PE=4 SV=1) HSP 1 Score: 118.2 bits (295), Expect = 6.6e-24 Identity = 58/113 (51.33%), Postives = 68/113 (60.18%), Query Frame = 1
BLAST of Cucsa.012670.1 vs. TrEMBL
Match: B9T3Z8_RICCO (Nutrient reservoir, putative OS=Ricinus communis GN=RCOM_0336770 PE=4 SV=1) HSP 1 Score: 109.4 bits (272), Expect = 3.1e-21 Identity = 59/114 (51.75%), Postives = 66/114 (57.89%), Query Frame = 1
BLAST of Cucsa.012670.1 vs. TrEMBL
Match: B9H394_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0004s08700g PE=4 SV=1) HSP 1 Score: 105.1 bits (261), Expect = 5.8e-20 Identity = 52/113 (46.02%), Postives = 66/113 (58.41%), Query Frame = 1
BLAST of Cucsa.012670.1 vs. TAIR10
Match: AT1G23040.1 (AT1G23040.1 hydroxyproline-rich glycoprotein family protein) HSP 1 Score: 79.0 bits (193), Expect = 2.2e-15 Identity = 34/65 (52.31%), Postives = 40/65 (61.54%), Query Frame = 1
BLAST of Cucsa.012670.1 vs. TAIR10
Match: AT3G22800.1 (AT3G22800.1 Leucine-rich repeat (LRR) family protein) HSP 1 Score: 67.4 bits (163), Expect = 6.8e-12 Identity = 32/70 (45.71%), Postives = 37/70 (52.86%), Query Frame = 1
HSP 2 Score: 50.8 bits (120), Expect = 6.5e-07 Identity = 24/56 (42.86%), Postives = 27/56 (48.21%), Query Frame = 1
BLAST of Cucsa.012670.1 vs. TAIR10
Match: AT1G70990.1 (AT1G70990.1 proline-rich family protein) HSP 1 Score: 66.2 bits (160), Expect = 1.5e-11 Identity = 34/73 (46.58%), Postives = 38/73 (52.05%), Query Frame = 1
BLAST of Cucsa.012670.1 vs. TAIR10
Match: AT3G03350.2 (AT3G03350.2 NAD(P)-binding Rossmann-fold superfamily protein) HSP 1 Score: 65.1 bits (157), Expect = 3.4e-11 Identity = 30/71 (42.25%), Postives = 41/71 (57.75%), Query Frame = 1
BLAST of Cucsa.012670.1 vs. TAIR10
Match: AT1G02405.1 (AT1G02405.1 proline-rich family protein) HSP 1 Score: 61.2 bits (147), Expect = 4.8e-10 Identity = 32/69 (46.38%), Postives = 37/69 (53.62%), Query Frame = 1
BLAST of Cucsa.012670.1 vs. NCBI nr
Match: gi|778680858|ref|XP_011651408.1| (PREDICTED: leucine-rich repeat extensin-like protein 3 [Cucumis sativus]) HSP 1 Score: 257.3 bits (656), Expect = 1.3e-65 Identity = 115/118 (97.46%), Postives = 115/118 (97.46%), Query Frame = 1
BLAST of Cucsa.012670.1 vs. NCBI nr
Match: gi|731417884|ref|XP_010660469.1| (PREDICTED: WAS/WASL-interacting protein family member 3-like [Vitis vinifera]) HSP 1 Score: 120.2 bits (300), Expect = 2.5e-24 Identity = 59/115 (51.30%), Postives = 69/115 (60.00%), Query Frame = 1
BLAST of Cucsa.012670.1 vs. NCBI nr
Match: gi|566211035|ref|XP_006372591.1| (hypothetical protein POPTR_0017s03030g [Populus trichocarpa]) HSP 1 Score: 119.4 bits (298), Expect = 4.2e-24 Identity = 60/116 (51.72%), Postives = 69/116 (59.48%), Query Frame = 1
BLAST of Cucsa.012670.1 vs. NCBI nr
Match: gi|697159392|ref|XP_009588454.1| (PREDICTED: leucine-rich repeat extensin-like protein 1 [Nicotiana tomentosiformis]) HSP 1 Score: 118.6 bits (296), Expect = 7.2e-24 Identity = 59/126 (46.83%), Postives = 69/126 (54.76%), Query Frame = 1
BLAST of Cucsa.012670.1 vs. NCBI nr
Match: gi|590652126|ref|XP_007033069.1| (Uncharacterized protein TCM_019232 [Theobroma cacao]) HSP 1 Score: 118.2 bits (295), Expect = 9.5e-24 Identity = 58/113 (51.33%), Postives = 68/113 (60.18%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this mRNA:
GO Assignments
This mRNA is annotated with the following GO terms.
This mRNA is a part of the following gene feature(s):
The following polypeptide feature(s) derives from this mRNA:
The following CDS feature(s) are a part of this mRNA:
Analysis Name: InterPro Annotations of cucumber (Gy14)
Date Performed: 2017-01-17
|