CmoCh20G001450.1 (mRNA) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: polypeptideexonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGTCTAAGTACTTACTCGTGGTCCCTACTCATTGTCCCGATGCACCATCCAACAAACCATATCATGTGTGCATTGGAAGGGAAACAAAAAGGGATGATGCATCATCCAGCAAACCATATAATGTGTAGATTGGAAGGGATGTTGGAATGCGTAAAATGACTGCGCTTAAAATCCTATTTAAATATAACCTGACTACCTCCCGAAATCAGGGAAGGGAAGGGAATACAGGGTCCTCTTCAGTCGCTTCTCTTTGGGCTGCCTTGAATTCCCCTCGGCCGACTGATTGATCTGATCCTTTCTTTCTTGCTTTCACTGCTCTTTCTCCTTTACTGGTATGGAGTCAGATGCTAGAAAATTCATTTCTAATAGATAATGCTACAAAGAAAATCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAATGTGTTAGGGCATCCCATTAGTAAGCCGACCTGGATCGATTCGTCGGATTTTTCTATTATTGATCGATTTGTGCAAAAATGGTCACAACGCATCGTGGAGAGTTTGCACCGGGAGTTGCTCTTCTAA ATGTCTAAGTACTTACTCGTGGTCCCTACTCATTGTCCCGATGCACCATCCAACAAACCATATCATATGCTAGAAAATTCATTTCTAATAGATAATGCTACAAAGAAAATCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAATGTGTTAGGGCATCCCATTAGTAAGCCGACCTGGATCGATTCGTCGGATTTTTCTATTATTGATCGATTTGTGCAAAAATGGTCACAACGCATCGTGGAGAGTTTGCACCGGGAGTTGCTCTTCTAA ATGTCTAAGTACTTACTCGTGGTCCCTACTCATTGTCCCGATGCACCATCCAACAAACCATATCATATGCTAGAAAATTCATTTCTAATAGATAATGCTACAAAGAAAATCGATACACTAGTTCCTATTATTACTCTGCTTGGATCATTGGCTAAAGCGAAATTTTGTAATGTGTTAGGGCATCCCATTAGTAAGCCGACCTGGATCGATTCGTCGGATTTTTCTATTATTGATCGATTTGTGCAAAAATGGTCACAACGCATCGTGGAGAGTTTGCACCGGGAGTTGCTCTTCTAA
BLAST of CmoCh20G001450.1 vs. Swiss-Prot
Match: MATK_CUCSA (Maturase K OS=Cucumis sativus GN=matK PE=3 SV=1) HSP 1 Score: 114.8 bits (286), Expect = 5.4e-25 Identity = 54/60 (90.00%), Postives = 58/60 (96.67%), Query Frame = 1
BLAST of CmoCh20G001450.1 vs. Swiss-Prot
Match: MATK_CAROR (Maturase K OS=Carpinus orientalis GN=matK PE=3 SV=1) HSP 1 Score: 108.2 bits (269), Expect = 5.1e-23 Identity = 51/73 (69.86%), Postives = 60/73 (82.19%), Query Frame = 1
BLAST of CmoCh20G001450.1 vs. Swiss-Prot
Match: MATK_CARBE (Maturase K OS=Carpinus betulus GN=matK PE=3 SV=1) HSP 1 Score: 108.2 bits (269), Expect = 5.1e-23 Identity = 51/73 (69.86%), Postives = 60/73 (82.19%), Query Frame = 1
BLAST of CmoCh20G001450.1 vs. Swiss-Prot
Match: MATK_VAUCA (Maturase K OS=Vauquelinia californica GN=matK PE=3 SV=1) HSP 1 Score: 104.8 bits (260), Expect = 5.6e-22 Identity = 49/59 (83.05%), Postives = 52/59 (88.14%), Query Frame = 1
BLAST of CmoCh20G001450.1 vs. Swiss-Prot
Match: MATK_OCHPY (Maturase K OS=Ochroma pyramidale GN=matK PE=3 SV=1) HSP 1 Score: 104.4 bits (259), Expect = 7.3e-22 Identity = 49/67 (73.13%), Postives = 56/67 (83.58%), Query Frame = 1
BLAST of CmoCh20G001450.1 vs. TrEMBL
Match: A0A0S2IGE8_CUCMO (Maturase K OS=Cucurbita moschata GN=matK PE=3 SV=1) HSP 1 Score: 122.1 bits (305), Expect = 3.8e-25 Identity = 59/60 (98.33%), Postives = 60/60 (100.00%), Query Frame = 1
BLAST of CmoCh20G001450.1 vs. TrEMBL
Match: A0A0S2IEX1_9ROSI (Maturase K OS=Cucurbita ficifolia GN=matK PE=3 SV=1) HSP 1 Score: 122.1 bits (305), Expect = 3.8e-25 Identity = 59/60 (98.33%), Postives = 60/60 (100.00%), Query Frame = 1
BLAST of CmoCh20G001450.1 vs. TrEMBL
Match: G8CZ17_CUCPE (Maturase K (Fragment) OS=Cucurbita pepo subsp. ovifera GN=matK PE=4 SV=1) HSP 1 Score: 122.1 bits (305), Expect = 3.8e-25 Identity = 59/60 (98.33%), Postives = 60/60 (100.00%), Query Frame = 1
BLAST of CmoCh20G001450.1 vs. TrEMBL
Match: G8CZ13_9ROSI (Maturase K (Fragment) OS=Cucurbita okeechobeensis subsp. okeechobeensis GN=matK PE=4 SV=1) HSP 1 Score: 122.1 bits (305), Expect = 3.8e-25 Identity = 59/60 (98.33%), Postives = 60/60 (100.00%), Query Frame = 1
BLAST of CmoCh20G001450.1 vs. TrEMBL
Match: G8CZ02_9ROSI (Maturase K (Fragment) OS=Cucurbita argyrosperma var. palmeri GN=matK PE=4 SV=1) HSP 1 Score: 122.1 bits (305), Expect = 3.8e-25 Identity = 59/60 (98.33%), Postives = 60/60 (100.00%), Query Frame = 1
BLAST of CmoCh20G001450.1 vs. TAIR10
Match: ATCG00040.1 (ATCG00040.1 maturase K) HSP 1 Score: 90.1 bits (222), Expect = 8.1e-19 Identity = 41/60 (68.33%), Postives = 50/60 (83.33%), Query Frame = 1
BLAST of CmoCh20G001450.1 vs. NCBI nr
Match: gi|111053131|gb|ABH03822.1| (maturase K, partial (chloroplast) [Cucurbita pepo]) HSP 1 Score: 122.1 bits (305), Expect = 5.4e-25 Identity = 59/60 (98.33%), Postives = 60/60 (100.00%), Query Frame = 1
BLAST of CmoCh20G001450.1 vs. NCBI nr
Match: gi|952955564|gb|ALO22910.1| (maturase K (plastid) [Cucurbita pedatifolia]) HSP 1 Score: 122.1 bits (305), Expect = 5.4e-25 Identity = 59/60 (98.33%), Postives = 60/60 (100.00%), Query Frame = 1
BLAST of CmoCh20G001450.1 vs. NCBI nr
Match: gi|1002159560|gb|AMM75946.1| (maturase K, partial (chloroplast) [Cucurbita pepo]) HSP 1 Score: 122.1 bits (305), Expect = 5.4e-25 Identity = 59/60 (98.33%), Postives = 60/60 (100.00%), Query Frame = 1
BLAST of CmoCh20G001450.1 vs. NCBI nr
Match: gi|353330131|gb|AEQ92174.1| (maturase K, partial (chloroplast) [Cucurbita cordata]) HSP 1 Score: 122.1 bits (305), Expect = 5.4e-25 Identity = 59/60 (98.33%), Postives = 60/60 (100.00%), Query Frame = 1
BLAST of CmoCh20G001450.1 vs. NCBI nr
Match: gi|111053129|gb|ABH03821.1| (maturase K, partial (chloroplast) [Cucurbita ficifolia]) HSP 1 Score: 122.1 bits (305), Expect = 5.4e-25 Identity = 59/60 (98.33%), Postives = 60/60 (100.00%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this mRNA:
GO Assignments
This mRNA is annotated with the following GO terms.
This mRNA is a part of the following gene feature(s):
The following polypeptide feature(s) derives from this mRNA:
The following exon feature(s) are a part of this mRNA:
The following CDS feature(s) are a part of this mRNA:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
|