CmoCh19G005570.1 (mRNA) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonfive_prime_UTRCDS Hold the cursor over a type above to highlight its positions in the sequence below.GCCCTGTTGTTCATTCTTTGTAGTTTTATAGTTATCGCTCTCGTCTCTCTGTTTGGCAACGAAGAAAAAATCAATCTGATCGTTCAAGCAATCTCAAGAGAAAAAGAGAGGGAAAAATGAGTTACTACAACCAGCCACCGCCTCCCGTCGGCGTTCCTCCGCCGCAAGGTAACATCTAAACCGATACTCTTACTTTTTCCCTTTCTTACTCCCGGCGCACTTTCTTTGATTTCTAAGGTTCAAATCGAATGGATCTTGCTGTTTTCTTCCACAAAATCGATTTAATCTTTGTTTTCGTTTCGATTTGACCGATTTTGGCTGCGATTCTGTGAATTTCAACGATTTTAGGTTATCCGCCGCAAGGATATCCGCCGAAAGACGCCTATCCACCACAAGGATATCCACCGCAGGGCGGTTATCCTCCTGCTGGTTATCCTCCGCAGGGATATCCGCCTCCGGCGTATGGTCCGGCGTACGGACCACCTCAGCCTCAACATTCAAACCAAAAGAAAGAAGTTGGATTCGTCGAAGGCTGGTAA GCCCTGTTGTTCATTCTTTGTAGTTTTATAGTTATCGCTCTCGTCTCTCTGTTTGGCAACGAAGAAAAAATCAATCTGATCGTTCAAGCAATCTCAAGAGAAAAAGAGAGGGAAAAATGAGTTACTACAACCAGCCACCGCCTCCCGTCGGCGTTCCTCCGCCGCAAGGTTATCCGCCGCAAGGATATCCGCCGAAAGACGCCTATCCACCACAAGGATATCCACCGCAGGGCGGTTATCCTCCTGCTGGTTATCCTCCGCAGGGATATCCGCCTCCGGCGTATGGTCCGGCGTACGGACCACCTCAGCCTCAACATTCAAACCAAAAGAAAGAAGTTGGATTCGTCGAAGGCTGGTAA ATGAGTTACTACAACCAGCCACCGCCTCCCGTCGGCGTTCCTCCGCCGCAAGGTTATCCGCCGCAAGGATATCCGCCGAAAGACGCCTATCCACCACAAGGATATCCACCGCAGGGCGGTTATCCTCCTGCTGGTTATCCTCCGCAGGGATATCCGCCTCCGGCGTATGGTCCGGCGTACGGACCACCTCAGCCTCAACATTCAAACCAAAAGAAAGAAGTTGGATTCGTCGAAGGCTGGTAA
BLAST of CmoCh19G005570.1 vs. Swiss-Prot
Match: CYT1A_ARATH (Cysteine-rich and transmembrane domain-containing protein A OS=Arabidopsis thaliana GN=At2g41420 PE=3 SV=1) HSP 1 Score: 100.5 bits (249), Expect = 8.7e-21 Identity = 60/87 (68.97%), Postives = 63/87 (72.41%), Query Frame = 1
BLAST of CmoCh19G005570.1 vs. Swiss-Prot
Match: OPSD_ENTDO (Rhodopsin OS=Enteroctopus dofleini GN=RHO PE=1 SV=1) HSP 1 Score: 68.9 bits (167), Expect = 2.8e-11 Identity = 43/62 (69.35%), Postives = 43/62 (69.35%), Query Frame = 1
BLAST of CmoCh19G005570.1 vs. Swiss-Prot
Match: OPSD_LOLFO (Rhodopsin OS=Loligo forbesi GN=RHO PE=1 SV=1) HSP 1 Score: 65.5 bits (158), Expect = 3.1e-10 Identity = 39/52 (75.00%), Postives = 39/52 (75.00%), Query Frame = 1
BLAST of CmoCh19G005570.1 vs. Swiss-Prot
Match: OPSD_ALLSU (Rhodopsin (Fragment) OS=Alloteuthis subulata GN=RHO PE=1 SV=1) HSP 1 Score: 65.5 bits (158), Expect = 3.1e-10 Identity = 39/52 (75.00%), Postives = 39/52 (75.00%), Query Frame = 1
BLAST of CmoCh19G005570.1 vs. Swiss-Prot
Match: CYT1B_ARATH (Cysteine-rich and transmembrane domain-containing protein B OS=Arabidopsis thaliana GN=At3g57160 PE=3 SV=2) HSP 1 Score: 65.1 bits (157), Expect = 4.0e-10 Identity = 46/86 (53.49%), Postives = 49/86 (56.98%), Query Frame = 1
BLAST of CmoCh19G005570.1 vs. TrEMBL
Match: A0A0A0K2W8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G070830 PE=4 SV=1) HSP 1 Score: 139.8 bits (351), Expect = 1.4e-30 Identity = 73/80 (91.25%), Postives = 73/80 (91.25%), Query Frame = 1
BLAST of CmoCh19G005570.1 vs. TrEMBL
Match: A0A022RF97_ERYGU (Uncharacterized protein OS=Erythranthe guttata GN=MIMGU_mgv1a017094mg PE=4 SV=1) HSP 1 Score: 106.7 bits (265), Expect = 1.3e-20 Identity = 59/80 (73.75%), Postives = 63/80 (78.75%), Query Frame = 1
BLAST of CmoCh19G005570.1 vs. TrEMBL
Match: A0A0D2ST80_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_008G020000 PE=4 SV=1) HSP 1 Score: 104.0 bits (258), Expect = 8.7e-20 Identity = 58/80 (72.50%), Postives = 60/80 (75.00%), Query Frame = 1
BLAST of CmoCh19G005570.1 vs. TrEMBL
Match: D7LH70_ARALL (Expressed protein (Fragment) OS=Arabidopsis lyrata subsp. lyrata GN=ARALYDRAFT_483214 PE=4 SV=1) HSP 1 Score: 101.7 bits (252), Expect = 4.3e-19 Identity = 60/83 (72.29%), Postives = 63/83 (75.90%), Query Frame = 1
BLAST of CmoCh19G005570.1 vs. TrEMBL
Match: A0A0D2TVE9_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_008G020000 PE=4 SV=1) HSP 1 Score: 99.8 bits (247), Expect = 1.6e-18 Identity = 57/79 (72.15%), Postives = 59/79 (74.68%), Query Frame = 1
BLAST of CmoCh19G005570.1 vs. TAIR10
Match: AT2G41420.1 (AT2G41420.1 proline-rich family protein) HSP 1 Score: 100.5 bits (249), Expect = 4.9e-22 Identity = 60/87 (68.97%), Postives = 63/87 (72.41%), Query Frame = 1
BLAST of CmoCh19G005570.1 vs. TAIR10
Match: AT3G49845.1 (AT3G49845.1 unknown protein) HSP 1 Score: 60.5 bits (145), Expect = 5.6e-10 Identity = 41/74 (55.41%), Postives = 43/74 (58.11%), Query Frame = 1
BLAST of CmoCh19G005570.1 vs. TAIR10
Match: AT5G67600.1 (AT5G67600.1 unknown protein) HSP 1 Score: 58.9 bits (141), Expect = 1.6e-09 Identity = 44/80 (55.00%), Postives = 47/80 (58.75%), Query Frame = 1
BLAST of CmoCh19G005570.1 vs. TAIR10
Match: AT5G17650.1 (AT5G17650.1 glycine/proline-rich protein) HSP 1 Score: 57.8 bits (138), Expect = 3.6e-09 Identity = 38/67 (56.72%), Postives = 41/67 (61.19%), Query Frame = 1
BLAST of CmoCh19G005570.1 vs. TAIR10
Match: AT5G45350.1 (AT5G45350.1 proline-rich family protein) HSP 1 Score: 56.2 bits (134), Expect = 1.1e-08 Identity = 36/62 (58.06%), Postives = 38/62 (61.29%), Query Frame = 1
BLAST of CmoCh19G005570.1 vs. NCBI nr
Match: gi|778724815|ref|XP_011658867.1| (PREDICTED: cysteine-rich and transmembrane domain-containing protein A-like [Cucumis sativus]) HSP 1 Score: 139.8 bits (351), Expect = 2.1e-30 Identity = 73/80 (91.25%), Postives = 73/80 (91.25%), Query Frame = 1
BLAST of CmoCh19G005570.1 vs. NCBI nr
Match: gi|659110097|ref|XP_008455047.1| (PREDICTED: CYSTM1 family protein A-like [Cucumis melo]) HSP 1 Score: 134.8 bits (338), Expect = 6.6e-29 Identity = 71/81 (87.65%), Postives = 72/81 (88.89%), Query Frame = 1
BLAST of CmoCh19G005570.1 vs. NCBI nr
Match: gi|848872427|ref|XP_012836776.1| (PREDICTED: cysteine-rich and transmembrane domain-containing protein A-like [Erythranthe guttata]) HSP 1 Score: 106.7 bits (265), Expect = 1.9e-20 Identity = 59/80 (73.75%), Postives = 63/80 (78.75%), Query Frame = 1
BLAST of CmoCh19G005570.1 vs. NCBI nr
Match: gi|763780233|gb|KJB47304.1| (hypothetical protein B456_008G020000 [Gossypium raimondii]) HSP 1 Score: 104.0 bits (258), Expect = 1.3e-19 Identity = 58/80 (72.50%), Postives = 60/80 (75.00%), Query Frame = 1
BLAST of CmoCh19G005570.1 vs. NCBI nr
Match: gi|727448578|ref|XP_010505922.1| (PREDICTED: cysteine-rich and transmembrane domain-containing protein A [Camelina sativa]) HSP 1 Score: 103.2 bits (256), Expect = 2.1e-19 Identity = 59/91 (64.84%), Postives = 61/91 (67.03%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this mRNA:
GO Assignments
This mRNA is annotated with the following GO terms.
This mRNA is a part of the following gene feature(s):
The following polypeptide feature(s) derives from this mRNA:
The following exon feature(s) are a part of this mRNA:
The following five_prime_UTR feature(s) are a part of this mRNA:
The following CDS feature(s) are a part of this mRNA:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
|