CmoCh19G005470.1 (mRNA) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGCCAACCAACATAAACATAACTGTAAGTTGGTGCACGCACGCGAACGATATGGAGAAAATCTTGCATGGAGCAGCTAAAACTTATGGGGCATTGCTGCAGTTTGGATGTGGGTCATCGAGAAGTAATATTACCATCCTCGCACCAATATTTGTGCGGCTGGTAAGGTGTGTGGCCATTACACTCAAGTGGTGCGGAAAAAGTCGGTGAGAATTGGATGTGCCAAAGTGAGATGCACAAACAATCGTGGTACGTTCATCACTTGCAACTATGATCCACCGGGCAATGTCAGAGGTCAAAGGCCATTCTAA ATGCCAACCAACATAAACATAACTGTAAGTTGGTGCACGCACGCGAACGATATGGAGAAAATCTTGCATGGAGCAGCTAAAACTTATGGGGCATTGCTGCAGTTTGGATGTGGGTCATCGAGAAGTAATATTACCATCCTCGCACCAATATTTGTGCGGCTGGTGTGTGGCCATTACACTCAAGTGGTGCGGAAAAAGTCGGTGAGAATTGGATGTGCCAAAGTGAGATGCACAAACAATCGTGGTACGTTCATCACTTGCAACTATGATCCACCGGGCAATGTCAGAGGTCAAAGGCCATTCTAA ATGCCAACCAACATAAACATAACTGTAAGTTGGTGCACGCACGCGAACGATATGGAGAAAATCTTGCATGGAGCAGCTAAAACTTATGGGGCATTGCTGCAGTTTGGATGTGGGTCATCGAGAAGTAATATTACCATCCTCGCACCAATATTTGTGCGGCTGGTGTGTGGCCATTACACTCAAGTGGTGCGGAAAAAGTCGGTGAGAATTGGATGTGCCAAAGTGAGATGCACAAACAATCGTGGTACGTTCATCACTTGCAACTATGATCCACCGGGCAATGTCAGAGGTCAAAGGCCATTCTAA
BLAST of CmoCh19G005470.1 vs. Swiss-Prot
Match: PRB1_ARATH (Pathogenesis-related protein 1 OS=Arabidopsis thaliana GN=PRB1 PE=2 SV=1) HSP 1 Score: 79.0 bits (193), Expect = 3.4e-14 Identity = 34/47 (72.34%), Postives = 39/47 (82.98%), Query Frame = 1
BLAST of CmoCh19G005470.1 vs. Swiss-Prot
Match: PR1_SAMNI (Pathogenesis-related protein PR-1 type OS=Sambucus nigra PE=2 SV=1) HSP 1 Score: 78.6 bits (192), Expect = 4.4e-14 Identity = 35/47 (74.47%), Postives = 38/47 (80.85%), Query Frame = 1
BLAST of CmoCh19G005470.1 vs. Swiss-Prot
Match: PR12_HORVU (Pathogenesis-related protein PRB1-2 OS=Hordeum vulgare PE=2 SV=1) HSP 1 Score: 78.6 bits (192), Expect = 4.4e-14 Identity = 32/47 (68.09%), Postives = 38/47 (80.85%), Query Frame = 1
BLAST of CmoCh19G005470.1 vs. Swiss-Prot
Match: PR13_HORVU (Pathogenesis-related protein PRB1-3 OS=Hordeum vulgare PE=2 SV=1) HSP 1 Score: 78.6 bits (192), Expect = 4.4e-14 Identity = 32/47 (68.09%), Postives = 38/47 (80.85%), Query Frame = 1
BLAST of CmoCh19G005470.1 vs. Swiss-Prot
Match: PR1_HORVU (Pathogenesis-related protein 1 OS=Hordeum vulgare PE=2 SV=1) HSP 1 Score: 78.6 bits (192), Expect = 4.4e-14 Identity = 32/47 (68.09%), Postives = 38/47 (80.85%), Query Frame = 1
BLAST of CmoCh19G005470.1 vs. TrEMBL
Match: A0A0A0K6A4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G070253 PE=3 SV=1) HSP 1 Score: 89.7 bits (221), Expect = 2.1e-15 Identity = 39/47 (82.98%), Postives = 41/47 (87.23%), Query Frame = 1
BLAST of CmoCh19G005470.1 vs. TrEMBL
Match: G7ILE4_MEDTR (CAP, cysteine-rich secretory protein, antigen 5 OS=Medicago truncatula GN=MTR_2g012370 PE=3 SV=1) HSP 1 Score: 88.2 bits (217), Expect = 6.2e-15 Identity = 36/47 (76.60%), Postives = 41/47 (87.23%), Query Frame = 1
BLAST of CmoCh19G005470.1 vs. TrEMBL
Match: I3S5U8_MEDTR (Uncharacterized protein OS=Medicago truncatula PE=2 SV=1) HSP 1 Score: 88.2 bits (217), Expect = 6.2e-15 Identity = 36/47 (76.60%), Postives = 41/47 (87.23%), Query Frame = 1
BLAST of CmoCh19G005470.1 vs. TrEMBL
Match: G7IFD1_MEDTR (CAP, cysteine-rich secretory protein, antigen 5 OS=Medicago truncatula GN=MTR_2g010600 PE=3 SV=1) HSP 1 Score: 88.2 bits (217), Expect = 6.2e-15 Identity = 36/47 (76.60%), Postives = 41/47 (87.23%), Query Frame = 1
BLAST of CmoCh19G005470.1 vs. TrEMBL
Match: M0UNM7_HORVD (Uncharacterized protein OS=Hordeum vulgare var. distichum PE=3 SV=1) HSP 1 Score: 87.8 bits (216), Expect = 8.2e-15 Identity = 36/47 (76.60%), Postives = 40/47 (85.11%), Query Frame = 1
BLAST of CmoCh19G005470.1 vs. TAIR10
Match: AT2G14580.1 (AT2G14580.1 basic pathogenesis-related protein 1) HSP 1 Score: 79.0 bits (193), Expect = 1.9e-15 Identity = 34/47 (72.34%), Postives = 39/47 (82.98%), Query Frame = 1
BLAST of CmoCh19G005470.1 vs. TAIR10
Match: AT2G14610.1 (AT2G14610.1 pathogenesis-related gene 1) HSP 1 Score: 75.5 bits (184), Expect = 2.1e-14 Identity = 33/47 (70.21%), Postives = 39/47 (82.98%), Query Frame = 1
BLAST of CmoCh19G005470.1 vs. TAIR10
Match: AT4G33710.1 (AT4G33710.1 CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein) HSP 1 Score: 74.3 bits (181), Expect = 4.7e-14 Identity = 32/46 (69.57%), Postives = 37/46 (80.43%), Query Frame = 1
BLAST of CmoCh19G005470.1 vs. TAIR10
Match: AT4G25790.1 (AT4G25790.1 CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein) HSP 1 Score: 74.3 bits (181), Expect = 4.7e-14 Identity = 28/47 (59.57%), Postives = 38/47 (80.85%), Query Frame = 1
BLAST of CmoCh19G005470.1 vs. TAIR10
Match: AT3G19690.1 (AT3G19690.1 CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein) HSP 1 Score: 73.9 bits (180), Expect = 6.2e-14 Identity = 33/46 (71.74%), Postives = 38/46 (82.61%), Query Frame = 1
BLAST of CmoCh19G005470.1 vs. NCBI nr
Match: gi|778724783|ref|XP_011658861.1| (PREDICTED: basic form of pathogenesis-related protein 1-like [Cucumis sativus]) HSP 1 Score: 89.7 bits (221), Expect = 3.1e-15 Identity = 39/47 (82.98%), Postives = 41/47 (87.23%), Query Frame = 1
BLAST of CmoCh19G005470.1 vs. NCBI nr
Match: gi|659110129|ref|XP_008455064.1| (PREDICTED: pathogenesis-related protein PRB1-2-like [Cucumis melo]) HSP 1 Score: 88.6 bits (218), Expect = 6.9e-15 Identity = 37/47 (78.72%), Postives = 42/47 (89.36%), Query Frame = 1
BLAST of CmoCh19G005470.1 vs. NCBI nr
Match: gi|357446351|ref|XP_003593453.1| (CAP, cysteine-rich secretory protein, antigen 5 [Medicago truncatula]) HSP 1 Score: 88.2 bits (217), Expect = 9.0e-15 Identity = 36/47 (76.60%), Postives = 41/47 (87.23%), Query Frame = 1
BLAST of CmoCh19G005470.1 vs. NCBI nr
Match: gi|357446161|ref|XP_003593358.1| (CAP, cysteine-rich secretory protein, antigen 5 [Medicago truncatula]) HSP 1 Score: 88.2 bits (217), Expect = 9.0e-15 Identity = 36/47 (76.60%), Postives = 41/47 (87.23%), Query Frame = 1
BLAST of CmoCh19G005470.1 vs. NCBI nr
Match: gi|388495148|gb|AFK35640.1| (unknown [Medicago truncatula]) HSP 1 Score: 88.2 bits (217), Expect = 9.0e-15 Identity = 36/47 (76.60%), Postives = 41/47 (87.23%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this mRNA:
GO Assignments
This mRNA is annotated with the following GO terms.
This mRNA is a part of the following gene feature(s):
The following polypeptide feature(s) derives from this mRNA:
The following CDS feature(s) are a part of this mRNA:
The following exon feature(s) are a part of this mRNA:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
|