CmoCh15G000730.1 (mRNA) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGTCGGATTGGGCACCGGTAGTGATCGGAGTTGTACTGTTCGTACTGCTCTCTCCAGGGCTTCTGTTCCAGTTTCCGGGGAATAATCGACAGTTTGAGTTTGGGAGTATGAAGACCAACGGAAAGGCCATCGCCATTCACACGCTCATTTTCTTTATCCTTTACGCCGTCTTCATTCTCGCTCTCCGTATCCACATCTATACTGGCTGA ATGTCGGATTGGGCACCGGTAGTGATCGGAGTTGTACTGTTCGTACTGCTCTCTCCAGGGCTTCTGTTCCAGTTTCCGGGGAATAATCGACAGTTTGAGTTTGGGAGTATGAAGACCAACGGAAAGGCCATCGCCATTCACACGCTCATTTTCTTTATCCTTTACGCCGTCTTCATTCTCGCTCTCCGTATCCACATCTATACTGGCTGA ATGTCGGATTGGGCACCGGTAGTGATCGGAGTTGTACTGTTCGTACTGCTCTCTCCAGGGCTTCTGTTCCAGTTTCCGGGGAATAATCGACAGTTTGAGTTTGGGAGTATGAAGACCAACGGAAAGGCCATCGCCATTCACACGCTCATTTTCTTTATCCTTTACGCCGTCTTCATTCTCGCTCTCCGTATCCACATCTATACTGGCTGA
BLAST of CmoCh15G000730.1 vs. TrEMBL
Match: A0A0A0LMK8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G406095 PE=4 SV=1) HSP 1 Score: 134.8 bits (338), Expect = 4.0e-29 Identity = 66/69 (95.65%), Postives = 68/69 (98.55%), Query Frame = 1
BLAST of CmoCh15G000730.1 vs. TrEMBL
Match: A0A164VTJ6_DAUCA (Uncharacterized protein OS=Daucus carota subsp. sativus GN=DCAR_021798 PE=4 SV=1) HSP 1 Score: 121.7 bits (304), Expect = 3.5e-25 Identity = 55/69 (79.71%), Postives = 65/69 (94.20%), Query Frame = 1
BLAST of CmoCh15G000730.1 vs. TrEMBL
Match: A0A067LD19_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_10107 PE=4 SV=1) HSP 1 Score: 119.4 bits (298), Expect = 1.7e-24 Identity = 56/69 (81.16%), Postives = 64/69 (92.75%), Query Frame = 1
BLAST of CmoCh15G000730.1 vs. TrEMBL
Match: A0A067FKC6_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g035267mg PE=4 SV=1) HSP 1 Score: 117.5 bits (293), Expect = 6.6e-24 Identity = 55/69 (79.71%), Postives = 63/69 (91.30%), Query Frame = 1
BLAST of CmoCh15G000730.1 vs. TrEMBL
Match: I3SMX5_MEDTR (Transmembrane protein, putative OS=Medicago truncatula GN=MTR_7g028940 PE=2 SV=1) HSP 1 Score: 117.1 bits (292), Expect = 8.6e-24 Identity = 58/69 (84.06%), Postives = 60/69 (86.96%), Query Frame = 1
BLAST of CmoCh15G000730.1 vs. TAIR10
Match: AT3G27030.1 (AT3G27030.1 unknown protein) HSP 1 Score: 110.9 bits (276), Expect = 3.1e-25 Identity = 50/69 (72.46%), Postives = 60/69 (86.96%), Query Frame = 1
BLAST of CmoCh15G000730.1 vs. TAIR10
Match: AT5G40970.1 (AT5G40970.1 Protein of unknown function (DUF 3339)) HSP 1 Score: 100.9 bits (250), Expect = 3.2e-22 Identity = 46/69 (66.67%), Postives = 57/69 (82.61%), Query Frame = 1
BLAST of CmoCh15G000730.1 vs. TAIR10
Match: AT3G48660.1 (AT3G48660.1 Protein of unknown function (DUF 3339)) HSP 1 Score: 92.4 bits (228), Expect = 1.1e-19 Identity = 41/69 (59.42%), Postives = 55/69 (79.71%), Query Frame = 1
BLAST of CmoCh15G000730.1 vs. TAIR10
Match: AT5G63500.1 (AT5G63500.1 Protein of unknown function (DUF 3339)) HSP 1 Score: 86.7 bits (213), Expect = 6.3e-18 Identity = 38/69 (55.07%), Postives = 53/69 (76.81%), Query Frame = 1
BLAST of CmoCh15G000730.1 vs. TAIR10
Match: AT5G08391.1 (AT5G08391.1 Protein of unknown function (DUF 3339)) HSP 1 Score: 85.9 bits (211), Expect = 1.1e-17 Identity = 37/69 (53.62%), Postives = 54/69 (78.26%), Query Frame = 1
BLAST of CmoCh15G000730.1 vs. NCBI nr
Match: gi|659081414|ref|XP_008441322.1| (PREDICTED: uncharacterized protein LOC103485472 [Cucumis melo]) HSP 1 Score: 134.8 bits (338), Expect = 5.7e-29 Identity = 66/69 (95.65%), Postives = 68/69 (98.55%), Query Frame = 1
BLAST of CmoCh15G000730.1 vs. NCBI nr
Match: gi|1021033053|gb|KZM90837.1| (hypothetical protein DCAR_021798 [Daucus carota subsp. sativus]) HSP 1 Score: 121.7 bits (304), Expect = 5.0e-25 Identity = 55/69 (79.71%), Postives = 65/69 (94.20%), Query Frame = 1
BLAST of CmoCh15G000730.1 vs. NCBI nr
Match: gi|1009151971|ref|XP_015893840.1| (PREDICTED: uncharacterized protein LOC107427943 isoform X2 [Ziziphus jujuba]) HSP 1 Score: 120.9 bits (302), Expect = 8.5e-25 Identity = 57/69 (82.61%), Postives = 64/69 (92.75%), Query Frame = 1
BLAST of CmoCh15G000730.1 vs. NCBI nr
Match: gi|1009151967|ref|XP_015893838.1| (PREDICTED: uncharacterized protein LOC107427943 isoform X1 [Ziziphus jujuba]) HSP 1 Score: 120.9 bits (302), Expect = 8.5e-25 Identity = 57/69 (82.61%), Postives = 64/69 (92.75%), Query Frame = 1
BLAST of CmoCh15G000730.1 vs. NCBI nr
Match: gi|802539280|ref|XP_012070240.1| (PREDICTED: uncharacterized protein LOC105632465 [Jatropha curcas]) HSP 1 Score: 119.4 bits (298), Expect = 2.5e-24 Identity = 56/69 (81.16%), Postives = 64/69 (92.75%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this mRNA:
GO Assignments
This mRNA is annotated with the following GO terms.
This mRNA is a part of the following gene feature(s):
The following polypeptide feature(s) derives from this mRNA:
The following CDS feature(s) are a part of this mRNA:
The following exon feature(s) are a part of this mRNA:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
|