CmoCh04G031000.1 (mRNA) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGAGTGCAGATTGGGGACCGGTTGTCGTGGCGGTGGCGCTGTTCATTGTCCTGTCACCAGGGTTGCTTTTTCAGTTGCCGGCGAGAATCAGGGTGGTGGAGTTTGGGAATATGAATACCAGTGGGATTGCCATTTTGGTGCACGCTATCATTTTCTTCTGCATACTCACCATTTTGGTCATCGCTATCGGTATTCACATACACGTTAACTGA ATGAGTGCAGATTGGGGACCGGTTGTCGTGGCGGTGGCGCTGTTCATTGTCCTGTCACCAGGGTTGCTTTTTCAGTTGCCGGCGAGAATCAGGGTGGTGGAGTTTGGGAATATGAATACCAGTGGGATTGCCATTTTGGTGCACGCTATCATTTTCTTCTGCATACTCACCATTTTGGTCATCGCTATCGGTATTCACATACACGTTAACTGA ATGAGTGCAGATTGGGGACCGGTTGTCGTGGCGGTGGCGCTGTTCATTGTCCTGTCACCAGGGTTGCTTTTTCAGTTGCCGGCGAGAATCAGGGTGGTGGAGTTTGGGAATATGAATACCAGTGGGATTGCCATTTTGGTGCACGCTATCATTTTCTTCTGCATACTCACCATTTTGGTCATCGCTATCGGTATTCACATACACGTTAACTGA
BLAST of CmoCh04G031000.1 vs. TrEMBL
Match: A0A0A0LQ54_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G406090 PE=4 SV=1) HSP 1 Score: 125.6 bits (314), Expect = 2.4e-26 Identity = 67/69 (97.10%), Postives = 69/69 (100.00%), Query Frame = 1
BLAST of CmoCh04G031000.1 vs. TrEMBL
Match: A0A151SQ49_CAJCA (Uncharacterized protein (Fragment) OS=Cajanus cajan GN=KK1_003118 PE=4 SV=1) HSP 1 Score: 122.1 bits (305), Expect = 2.7e-25 Identity = 62/70 (88.57%), Postives = 68/70 (97.14%), Query Frame = 1
BLAST of CmoCh04G031000.1 vs. TrEMBL
Match: A0A0B2R8Q9_GLYSO (Uncharacterized protein OS=Glycine soja GN=glysoja_040168 PE=4 SV=1) HSP 1 Score: 120.6 bits (301), Expect = 7.9e-25 Identity = 61/70 (87.14%), Postives = 67/70 (95.71%), Query Frame = 1
BLAST of CmoCh04G031000.1 vs. TrEMBL
Match: V7CWH9_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_001G092200g PE=4 SV=1) HSP 1 Score: 120.6 bits (301), Expect = 7.9e-25 Identity = 60/70 (85.71%), Postives = 67/70 (95.71%), Query Frame = 1
BLAST of CmoCh04G031000.1 vs. TrEMBL
Match: A0A0S3RW63_PHAAN (Uncharacterized protein OS=Vigna angularis var. angularis GN=Vigan.04G224600 PE=4 SV=1) HSP 1 Score: 120.6 bits (301), Expect = 7.9e-25 Identity = 61/70 (87.14%), Postives = 67/70 (95.71%), Query Frame = 1
BLAST of CmoCh04G031000.1 vs. TAIR10
Match: AT5G40980.1 (AT5G40980.1 Protein of unknown function (DUF 3339)) HSP 1 Score: 114.0 bits (284), Expect = 3.7e-26 Identity = 59/68 (86.76%), Postives = 66/68 (97.06%), Query Frame = 1
BLAST of CmoCh04G031000.1 vs. TAIR10
Match: AT3G27027.1 (AT3G27027.1 Protein of unknown function (DUF 3339)) HSP 1 Score: 112.1 bits (279), Expect = 1.4e-25 Identity = 59/68 (86.76%), Postives = 63/68 (92.65%), Query Frame = 1
BLAST of CmoCh04G031000.1 vs. TAIR10
Match: AT3G01940.1 (AT3G01940.1 Protein of unknown function (DUF 3339)) HSP 1 Score: 101.3 bits (251), Expect = 2.5e-22 Identity = 54/67 (80.60%), Postives = 60/67 (89.55%), Query Frame = 1
BLAST of CmoCh04G031000.1 vs. TAIR10
Match: AT5G63500.1 (AT5G63500.1 Protein of unknown function (DUF 3339)) HSP 1 Score: 92.4 bits (228), Expect = 1.2e-19 Identity = 48/66 (72.73%), Postives = 57/66 (86.36%), Query Frame = 1
BLAST of CmoCh04G031000.1 vs. TAIR10
Match: AT3G48660.1 (AT3G48660.1 Protein of unknown function (DUF 3339)) HSP 1 Score: 91.7 bits (226), Expect = 2.0e-19 Identity = 48/66 (72.73%), Postives = 57/66 (86.36%), Query Frame = 1
BLAST of CmoCh04G031000.1 vs. NCBI nr
Match: gi|659081412|ref|XP_008441321.1| (PREDICTED: uncharacterized protein LOC103485471 [Cucumis melo]) HSP 1 Score: 125.6 bits (314), Expect = 3.5e-26 Identity = 67/69 (97.10%), Postives = 69/69 (100.00%), Query Frame = 1
BLAST of CmoCh04G031000.1 vs. NCBI nr
Match: gi|1000983056|ref|XP_015571582.1| (PREDICTED: uncharacterized protein LOC8271434 [Ricinus communis]) HSP 1 Score: 123.2 bits (308), Expect = 1.7e-25 Identity = 62/70 (88.57%), Postives = 69/70 (98.57%), Query Frame = 1
BLAST of CmoCh04G031000.1 vs. NCBI nr
Match: gi|1012345677|gb|KYP56869.1| (hypothetical protein KK1_003118, partial [Cajanus cajan]) HSP 1 Score: 122.1 bits (305), Expect = 3.9e-25 Identity = 62/70 (88.57%), Postives = 68/70 (97.14%), Query Frame = 1
BLAST of CmoCh04G031000.1 vs. NCBI nr
Match: gi|802539274|ref|XP_012070210.1| (PREDICTED: uncharacterized protein LOC105632436 [Jatropha curcas]) HSP 1 Score: 120.9 bits (302), Expect = 8.7e-25 Identity = 58/70 (82.86%), Postives = 68/70 (97.14%), Query Frame = 1
BLAST of CmoCh04G031000.1 vs. NCBI nr
Match: gi|965670185|dbj|BAT84792.1| (hypothetical protein VIGAN_04224600 [Vigna angularis var. angularis]) HSP 1 Score: 120.6 bits (301), Expect = 1.1e-24 Identity = 61/70 (87.14%), Postives = 67/70 (95.71%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this mRNA:
GO Assignments
This mRNA is annotated with the following GO terms.
This mRNA is a part of the following gene feature(s):
The following polypeptide feature(s) derives from this mRNA:
The following CDS feature(s) are a part of this mRNA:
The following exon feature(s) are a part of this mRNA:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
|