CmoCh04G027830.1 (mRNA) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCTGCTCTGGTCGGTGCTTCTGCAACTGCTTCGAATCCTACTGCCAACGATCCCCCTTTTTACTTCGACGAGAAATGGAGGCTGTCCAAGAAAGAAGGCTTAACCAGAACCCGCTCCTCCTCTTTCCCTCTCGTAAAAAACTCCTCTCTTAGAAGGTGTTCTTTCACTAGAAAGTGTGCCAGATTGGTCAAAGAACAGAGGGCTCGATTCTACATCATGAGACGATGCGTCACCATGCTCATCTGCTGGCACGATTACACCGATTCTTGA ATGGCTGCTCTGGTCGGTGCTTCTGCAACTGCTTCGAATCCTACTGCCAACGATCCCCCTTTTTACTTCGACGAGAAATGGAGGCTGTCCAAGAAAGAAGGCTTAACCAGAACCCGCTCCTCCTCTTTCCCTCTCGTAAAAAACTCCTCTCTTAGAAGGTGTTCTTTCACTAGAAAGTGTGCCAGATTGGTCAAAGAACAGAGGGCTCGATTCTACATCATGAGACGATGCGTCACCATGCTCATCTGCTGGCACGATTACACCGATTCTTGA ATGGCTGCTCTGGTCGGTGCTTCTGCAACTGCTTCGAATCCTACTGCCAACGATCCCCCTTTTTACTTCGACGAGAAATGGAGGCTGTCCAAGAAAGAAGGCTTAACCAGAACCCGCTCCTCCTCTTTCCCTCTCGTAAAAAACTCCTCTCTTAGAAGGTGTTCTTTCACTAGAAAGTGTGCCAGATTGGTCAAAGAACAGAGGGCTCGATTCTACATCATGAGACGATGCGTCACCATGCTCATCTGCTGGCACGATTACACCGATTCTTGA
BLAST of CmoCh04G027830.1 vs. TrEMBL
Match: A0A0A0KUB0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G517730 PE=4 SV=1) HSP 1 Score: 153.7 bits (387), Expect = 1.1e-34 Identity = 76/93 (81.72%), Postives = 82/93 (88.17%), Query Frame = 1
BLAST of CmoCh04G027830.1 vs. TrEMBL
Match: W9R2B1_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_025336 PE=4 SV=1) HSP 1 Score: 126.7 bits (317), Expect = 1.4e-26 Identity = 65/91 (71.43%), Postives = 72/91 (79.12%), Query Frame = 1
BLAST of CmoCh04G027830.1 vs. TrEMBL
Match: V7B6F3_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_008G191700g PE=4 SV=1) HSP 1 Score: 126.3 bits (316), Expect = 1.8e-26 Identity = 58/79 (73.42%), Postives = 66/79 (83.54%), Query Frame = 1
BLAST of CmoCh04G027830.1 vs. TrEMBL
Match: B9HTG9_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0010s20930g PE=4 SV=1) HSP 1 Score: 125.6 bits (314), Expect = 3.1e-26 Identity = 58/81 (71.60%), Postives = 70/81 (86.42%), Query Frame = 1
BLAST of CmoCh04G027830.1 vs. TrEMBL
Match: A0A0S3RKU3_PHAAN (Uncharacterized protein OS=Vigna angularis var. angularis GN=Vigan.03G088500 PE=4 SV=1) HSP 1 Score: 125.2 bits (313), Expect = 4.1e-26 Identity = 57/79 (72.15%), Postives = 66/79 (83.54%), Query Frame = 1
BLAST of CmoCh04G027830.1 vs. TAIR10
Match: AT2G39705.1 (AT2G39705.1 ROTUNDIFOLIA like 8) HSP 1 Score: 92.4 bits (228), Expect = 1.5e-19 Identity = 47/74 (63.51%), Postives = 55/74 (74.32%), Query Frame = 1
BLAST of CmoCh04G027830.1 vs. TAIR10
Match: AT3G55515.1 (AT3G55515.1 ROTUNDIFOLIA like 7) HSP 1 Score: 65.5 bits (158), Expect = 2.0e-11 Identity = 38/70 (54.29%), Postives = 43/70 (61.43%), Query Frame = 1
BLAST of CmoCh04G027830.1 vs. TAIR10
Match: AT2G29125.1 (AT2G29125.1 ROTUNDIFOLIA like 2) HSP 1 Score: 58.2 bits (139), Expect = 3.1e-09 Identity = 29/53 (54.72%), Postives = 37/53 (69.81%), Query Frame = 1
BLAST of CmoCh04G027830.1 vs. TAIR10
Match: AT5G59510.1 (AT5G59510.1 ROTUNDIFOLIA like 5) HSP 1 Score: 56.6 bits (135), Expect = 9.1e-09 Identity = 35/93 (37.63%), Postives = 51/93 (54.84%), Query Frame = 1
BLAST of CmoCh04G027830.1 vs. TAIR10
Match: AT2G36985.1 (AT2G36985.1 DVL family protein) HSP 1 Score: 54.7 bits (130), Expect = 3.5e-08 Identity = 22/41 (53.66%), Postives = 33/41 (80.49%), Query Frame = 1
BLAST of CmoCh04G027830.1 vs. NCBI nr
Match: gi|778703484|ref|XP_011655374.1| (PREDICTED: uncharacterized protein LOC105435519 [Cucumis sativus]) HSP 1 Score: 153.7 bits (387), Expect = 1.5e-34 Identity = 76/93 (81.72%), Postives = 82/93 (88.17%), Query Frame = 1
BLAST of CmoCh04G027830.1 vs. NCBI nr
Match: gi|703099220|ref|XP_010096589.1| (hypothetical protein L484_025336 [Morus notabilis]) HSP 1 Score: 126.7 bits (317), Expect = 2.0e-26 Identity = 65/91 (71.43%), Postives = 72/91 (79.12%), Query Frame = 1
BLAST of CmoCh04G027830.1 vs. NCBI nr
Match: gi|694352127|ref|XP_009357749.1| (PREDICTED: uncharacterized protein LOC103948440 [Pyrus x bretschneideri]) HSP 1 Score: 126.3 bits (316), Expect = 2.6e-26 Identity = 65/89 (73.03%), Postives = 74/89 (83.15%), Query Frame = 1
BLAST of CmoCh04G027830.1 vs. NCBI nr
Match: gi|593489055|ref|XP_007141395.1| (hypothetical protein PHAVU_008G191700g [Phaseolus vulgaris]) HSP 1 Score: 126.3 bits (316), Expect = 2.6e-26 Identity = 58/79 (73.42%), Postives = 66/79 (83.54%), Query Frame = 1
BLAST of CmoCh04G027830.1 vs. NCBI nr
Match: gi|224112731|ref|XP_002316275.1| (hypothetical protein POPTR_0010s20930g [Populus trichocarpa]) HSP 1 Score: 125.6 bits (314), Expect = 4.5e-26 Identity = 58/81 (71.60%), Postives = 70/81 (86.42%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this mRNA:
GO Assignments
This mRNA is annotated with the following GO terms.
This mRNA is a part of the following gene feature(s):
The following polypeptide feature(s) derives from this mRNA:
The following exon feature(s) are a part of this mRNA:
The following CDS feature(s) are a part of this mRNA:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
|