CmoCh04G026940.1 (mRNA) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonfive_prime_UTRCDS Hold the cursor over a type above to highlight its positions in the sequence below.TTTGGAATTCTGCTCTGTTGAACTCTGAGACGACCTAGGGTTTACTTTCTTGGGGGGAAGAAGAAGAGGAAGAGGAAGAAGAAGAAGATGATCGAGGTGGTGCTGAACGATCGGCTGGGGAAGAAGGTGAGAGTGAAGTGCAACGAGGACGACACCATCGGCGACTTGAAGAAGCTTGTGGCTGCTCAGACTGGGACTAGAGCCGAGAAGATTCGGATTCAGAAATGGTACAATATCTACAAGGATCATATTACTCTGAGGGATTACGAAGTCCACGATGGCATGGGCCTTGAACTCTACTACAATTAA TTTGGAATTCTGCTCTGTTGAACTCTGAGACGACCTAGGGTTTACTTTCTTGGGGGGAAGAAGAAGAGGAAGAGGAAGAAGAAGAAGATGATCGAGGTGGTGCTGAACGATCGGCTGGGGAAGAAGGTGAGAGTGAAGTGCAACGAGGACGACACCATCGGCGACTTGAAGAAGCTTGTGGCTGCTCAGACTGGGACTAGAGCCGAGAAGATTCGGATTCAGAAATGGTACAATATCTACAAGGATCATATTACTCTGAGGGATTACGAAGTCCACGATGGCATGGGCCTTGAACTCTACTACAATTAA ATGATCGAGGTGGTGCTGAACGATCGGCTGGGGAAGAAGGTGAGAGTGAAGTGCAACGAGGACGACACCATCGGCGACTTGAAGAAGCTTGTGGCTGCTCAGACTGGGACTAGAGCCGAGAAGATTCGGATTCAGAAATGGTACAATATCTACAAGGATCATATTACTCTGAGGGATTACGAAGTCCACGATGGCATGGGCCTTGAACTCTACTACAATTAA
BLAST of CmoCh04G026940.1 vs. Swiss-Prot
Match: UBL5_ARATH (Ubiquitin-like protein 5 OS=Arabidopsis thaliana GN=UBL5 PE=3 SV=1) HSP 1 Score: 149.8 bits (377), Expect = 1.1e-35 Identity = 70/73 (95.89%), Postives = 73/73 (100.00%), Query Frame = 1
BLAST of CmoCh04G026940.1 vs. Swiss-Prot
Match: UBL5_BOVIN (Ubiquitin-like protein 5 OS=Bos taurus GN=UBL5 PE=3 SV=1) HSP 1 Score: 124.4 bits (311), Expect = 5.1e-28 Identity = 57/72 (79.17%), Postives = 64/72 (88.89%), Query Frame = 1
BLAST of CmoCh04G026940.1 vs. Swiss-Prot
Match: UBL5_PSAOB (Ubiquitin-like protein 5 OS=Psammomys obesus GN=UBL5 PE=3 SV=1) HSP 1 Score: 124.4 bits (311), Expect = 5.1e-28 Identity = 57/72 (79.17%), Postives = 64/72 (88.89%), Query Frame = 1
BLAST of CmoCh04G026940.1 vs. Swiss-Prot
Match: UBL5_MOUSE (Ubiquitin-like protein 5 OS=Mus musculus GN=Ubl5 PE=1 SV=1) HSP 1 Score: 124.4 bits (311), Expect = 5.1e-28 Identity = 57/72 (79.17%), Postives = 64/72 (88.89%), Query Frame = 1
BLAST of CmoCh04G026940.1 vs. Swiss-Prot
Match: UBL5_MESAU (Ubiquitin-like protein 5 OS=Mesocricetus auratus GN=UBL5 PE=3 SV=1) HSP 1 Score: 124.4 bits (311), Expect = 5.1e-28 Identity = 57/72 (79.17%), Postives = 64/72 (88.89%), Query Frame = 1
BLAST of CmoCh04G026940.1 vs. TrEMBL
Match: A0A078H902_BRANA (BnaA01g24730D protein OS=Brassica napus GN=BnaA01g24730D PE=4 SV=1) HSP 1 Score: 151.0 bits (380), Expect = 5.7e-34 Identity = 71/73 (97.26%), Postives = 73/73 (100.00%), Query Frame = 1
BLAST of CmoCh04G026940.1 vs. TrEMBL
Match: D7MTG3_ARALL (Ubiquitin family protein OS=Arabidopsis lyrata subsp. lyrata GN=ARALYDRAFT_917558 PE=4 SV=1) HSP 1 Score: 151.0 bits (380), Expect = 5.7e-34 Identity = 71/73 (97.26%), Postives = 73/73 (100.00%), Query Frame = 1
BLAST of CmoCh04G026940.1 vs. TrEMBL
Match: M4E4Y0_BRARP (Uncharacterized protein OS=Brassica rapa subsp. pekinensis PE=4 SV=1) HSP 1 Score: 151.0 bits (380), Expect = 5.7e-34 Identity = 71/73 (97.26%), Postives = 73/73 (100.00%), Query Frame = 1
BLAST of CmoCh04G026940.1 vs. TrEMBL
Match: A0A0D3ABK7_BRAOL (Uncharacterized protein OS=Brassica oleracea var. oleracea GN=UBL5 PE=4 SV=1) HSP 1 Score: 151.0 bits (380), Expect = 5.7e-34 Identity = 71/73 (97.26%), Postives = 73/73 (100.00%), Query Frame = 1
BLAST of CmoCh04G026940.1 vs. TrEMBL
Match: A0A164ZFL5_DAUCA (Uncharacterized protein OS=Daucus carota subsp. sativus GN=DCAR_019101 PE=4 SV=1) HSP 1 Score: 151.0 bits (380), Expect = 5.7e-34 Identity = 71/73 (97.26%), Postives = 73/73 (100.00%), Query Frame = 1
BLAST of CmoCh04G026940.1 vs. TAIR10
Match: AT5G42300.1 (AT5G42300.1 ubiquitin-like protein 5) HSP 1 Score: 149.8 bits (377), Expect = 6.4e-37 Identity = 70/73 (95.89%), Postives = 73/73 (100.00%), Query Frame = 1
BLAST of CmoCh04G026940.1 vs. TAIR10
Match: AT3G45180.1 (AT3G45180.1 Ubiquitin-like superfamily protein) HSP 1 Score: 145.2 bits (365), Expect = 1.6e-35 Identity = 68/73 (93.15%), Postives = 71/73 (97.26%), Query Frame = 1
BLAST of CmoCh04G026940.1 vs. NCBI nr
Match: gi|1021038076|gb|KZM95859.1| (hypothetical protein DCAR_019101 [Daucus carota subsp. sativus]) HSP 1 Score: 151.0 bits (380), Expect = 8.1e-34 Identity = 71/73 (97.26%), Postives = 73/73 (100.00%), Query Frame = 1
BLAST of CmoCh04G026940.1 vs. NCBI nr
Match: gi|672123820|ref|XP_008785280.1| (PREDICTED: ubiquitin-like protein 5 [Phoenix dactylifera]) HSP 1 Score: 151.0 bits (380), Expect = 8.1e-34 Identity = 71/73 (97.26%), Postives = 73/73 (100.00%), Query Frame = 1
BLAST of CmoCh04G026940.1 vs. NCBI nr
Match: gi|297791835|ref|XP_002863802.1| (ubiquitin family protein [Arabidopsis lyrata subsp. lyrata]) HSP 1 Score: 151.0 bits (380), Expect = 8.1e-34 Identity = 71/73 (97.26%), Postives = 73/73 (100.00%), Query Frame = 1
BLAST of CmoCh04G026940.1 vs. NCBI nr
Match: gi|77553656|gb|ABA96452.1| (GRF zinc finger family protein [Oryza sativa Japonica Group]) HSP 1 Score: 150.2 bits (378), Expect = 1.4e-33 Identity = 71/73 (97.26%), Postives = 72/73 (98.63%), Query Frame = 1
BLAST of CmoCh04G026940.1 vs. NCBI nr
Match: gi|937940947|dbj|BAT15859.1| (Os12g0143100, partial [Oryza sativa Japonica Group]) HSP 1 Score: 150.2 bits (378), Expect = 1.4e-33 Identity = 71/73 (97.26%), Postives = 72/73 (98.63%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this mRNA:
GO Assignments
This mRNA is annotated with the following GO terms.
This mRNA is a part of the following gene feature(s):
The following polypeptide feature(s) derives from this mRNA:
The following CDS feature(s) are a part of this mRNA:
The following five_prime_UTR feature(s) are a part of this mRNA:
The following exon feature(s) are a part of this mRNA:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
|