CmoCh04G020940.1 (mRNA) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCCGCTTTCATGTTCCTCCTCGCCCTAACCAATGCTCAAAACACCCCTGGTGACTATCTCGCGCTTCACAACCGCGCTCGAGCCCAGGTCGGCGTCGGCCTCATGCAATGGAGCAATACCGTGGCCGCGTACGCTCAAGCCTATGCGGAAAAAAGAAAGGGTGACTGCGCCATGATTCACTCAACCGGGCCGTACGGGGAAAACATAGCCGCTGGGTACTACCCTGAGTTCACTGTGGTGGATGCGGTGAAGCTGTGGGCGAACGAGAAGCCGTTGTATGATCATGCGTCGAATAAATGCGTGGGTGGTGAATGTGGGCACTACACTCAGATGGTGTGGTGA ATGGCCGCTTTCATGTTCCTCCTCGCCCTAACCAATGCTCAAAACACCCCTGGTGACTATCTCGCGCTTCACAACCGCGCTCGAGCCCAGGTCGGCGTCGGCCTCATGCAATGGAGCAATACCGTGGCCGCGTACGCTCAAGCCTATGCGGAAAAAAGAAAGGGTGACTGCGCCATGATTCACTCAACCGGGCCGTACGGGGAAAACATAGCCGCTGGGTACTACCCTGAGTTCACTGTGGTGGATGCGGTGAAGCTGTGGGCGAACGAGAAGCCGTTGTATGATCATGCGTCGAATAAATGCGTGGGTGGTGAATGTGGGCACTACACTCAGATGGTGTGGTGA ATGGCCGCTTTCATGTTCCTCCTCGCCCTAACCAATGCTCAAAACACCCCTGGTGACTATCTCGCGCTTCACAACCGCGCTCGAGCCCAGGTCGGCGTCGGCCTCATGCAATGGAGCAATACCGTGGCCGCGTACGCTCAAGCCTATGCGGAAAAAAGAAAGGGTGACTGCGCCATGATTCACTCAACCGGGCCGTACGGGGAAAACATAGCCGCTGGGTACTACCCTGAGTTCACTGTGGTGGATGCGGTGAAGCTGTGGGCGAACGAGAAGCCGTTGTATGATCATGCGTCGAATAAATGCGTGGGTGGTGAATGTGGGCACTACACTCAGATGGTGTGGTGA
BLAST of CmoCh04G020940.1 vs. Swiss-Prot
Match: PRB1_TOBAC (Basic form of pathogenesis-related protein 1 OS=Nicotiana tabacum PE=3 SV=1) HSP 1 Score: 147.5 bits (371), Expect = 8.8e-35 Identity = 67/111 (60.36%), Postives = 79/111 (71.17%), Query Frame = 1
BLAST of CmoCh04G020940.1 vs. Swiss-Prot
Match: PR1_ARATH (Pathogenesis-related protein 1 OS=Arabidopsis thaliana GN=At2g14610 PE=1 SV=1) HSP 1 Score: 125.9 bits (315), Expect = 2.7e-28 Identity = 58/108 (53.70%), Postives = 79/108 (73.15%), Query Frame = 1
BLAST of CmoCh04G020940.1 vs. Swiss-Prot
Match: PR04_SOLLC (Pathogenesis-related leaf protein 4 OS=Solanum lycopersicum PE=2 SV=1) HSP 1 Score: 122.1 bits (305), Expect = 4.0e-27 Identity = 60/103 (58.25%), Postives = 76/103 (73.79%), Query Frame = 1
BLAST of CmoCh04G020940.1 vs. Swiss-Prot
Match: PR1A_SOLLC (Pathogenesis-related protein 1A1 OS=Solanum lycopersicum PE=2 SV=1) HSP 1 Score: 121.7 bits (304), Expect = 5.2e-27 Identity = 56/105 (53.33%), Postives = 71/105 (67.62%), Query Frame = 1
BLAST of CmoCh04G020940.1 vs. Swiss-Prot
Match: PR1B_TOBAC (Pathogenesis-related protein 1B OS=Nicotiana tabacum PE=2 SV=1) HSP 1 Score: 121.3 bits (303), Expect = 6.8e-27 Identity = 56/112 (50.00%), Postives = 71/112 (63.39%), Query Frame = 1
BLAST of CmoCh04G020940.1 vs. TrEMBL
Match: A0A0A0KHP4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G483242 PE=3 SV=1) HSP 1 Score: 184.9 bits (468), Expect = 5.5e-44 Identity = 80/110 (72.73%), Postives = 92/110 (83.64%), Query Frame = 1
BLAST of CmoCh04G020940.1 vs. TrEMBL
Match: A0A0A0LLX7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G381130 PE=3 SV=1) HSP 1 Score: 184.1 bits (466), Expect = 9.4e-44 Identity = 80/111 (72.07%), Postives = 91/111 (81.98%), Query Frame = 1
BLAST of CmoCh04G020940.1 vs. TrEMBL
Match: A0A0A0LSG5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G381380 PE=3 SV=1) HSP 1 Score: 178.3 bits (451), Expect = 5.2e-42 Identity = 78/111 (70.27%), Postives = 89/111 (80.18%), Query Frame = 1
BLAST of CmoCh04G020940.1 vs. TrEMBL
Match: G1FU08_9ROSI (Pathogenesis-related protein OS=Vitis quinquangularis GN=PR-1 PE=2 SV=1) HSP 1 Score: 152.5 bits (384), Expect = 3.0e-34 Identity = 69/102 (67.65%), Postives = 77/102 (75.49%), Query Frame = 1
BLAST of CmoCh04G020940.1 vs. TrEMBL
Match: E2GEV9_9ROSI (Pathogenesis-related protein 1 OS=Vitis hybrid cultivar GN=PR-1 PE=3 SV=1) HSP 1 Score: 150.6 bits (379), Expect = 1.2e-33 Identity = 68/102 (66.67%), Postives = 78/102 (76.47%), Query Frame = 1
BLAST of CmoCh04G020940.1 vs. TAIR10
Match: AT1G50060.1 (AT1G50060.1 CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein) HSP 1 Score: 142.1 bits (357), Expect = 2.1e-34 Identity = 65/115 (56.52%), Postives = 79/115 (68.70%), Query Frame = 1
BLAST of CmoCh04G020940.1 vs. TAIR10
Match: AT1G50050.1 (AT1G50050.1 CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein) HSP 1 Score: 125.9 bits (315), Expect = 1.5e-29 Identity = 63/116 (54.31%), Postives = 75/116 (64.66%), Query Frame = 1
BLAST of CmoCh04G020940.1 vs. TAIR10
Match: AT2G14610.1 (AT2G14610.1 pathogenesis-related gene 1) HSP 1 Score: 125.9 bits (315), Expect = 1.5e-29 Identity = 58/108 (53.70%), Postives = 79/108 (73.15%), Query Frame = 1
BLAST of CmoCh04G020940.1 vs. TAIR10
Match: AT4G33720.1 (AT4G33720.1 CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein) HSP 1 Score: 125.2 bits (313), Expect = 2.6e-29 Identity = 61/112 (54.46%), Postives = 79/112 (70.54%), Query Frame = 1
BLAST of CmoCh04G020940.1 vs. TAIR10
Match: AT2G14580.1 (AT2G14580.1 basic pathogenesis-related protein 1) HSP 1 Score: 118.6 bits (296), Expect = 2.5e-27 Identity = 55/108 (50.93%), Postives = 74/108 (68.52%), Query Frame = 1
BLAST of CmoCh04G020940.1 vs. NCBI nr
Match: gi|778722387|ref|XP_011658476.1| (PREDICTED: basic form of pathogenesis-related protein 1-like [Cucumis sativus]) HSP 1 Score: 187.2 bits (474), Expect = 1.6e-44 Identity = 81/111 (72.97%), Postives = 93/111 (83.78%), Query Frame = 1
BLAST of CmoCh04G020940.1 vs. NCBI nr
Match: gi|700193135|gb|KGN48339.1| (hypothetical protein Csa_6G483242 [Cucumis sativus]) HSP 1 Score: 184.9 bits (468), Expect = 7.9e-44 Identity = 80/110 (72.73%), Postives = 92/110 (83.64%), Query Frame = 1
BLAST of CmoCh04G020940.1 vs. NCBI nr
Match: gi|700207816|gb|KGN62935.1| (hypothetical protein Csa_2G381130 [Cucumis sativus]) HSP 1 Score: 184.1 bits (466), Expect = 1.4e-43 Identity = 80/111 (72.07%), Postives = 91/111 (81.98%), Query Frame = 1
BLAST of CmoCh04G020940.1 vs. NCBI nr
Match: gi|659109009|ref|XP_008454501.1| (PREDICTED: basic form of pathogenesis-related protein 1-like [Cucumis melo]) HSP 1 Score: 180.3 bits (456), Expect = 2.0e-42 Identity = 79/113 (69.91%), Postives = 94/113 (83.19%), Query Frame = 1
BLAST of CmoCh04G020940.1 vs. NCBI nr
Match: gi|700207817|gb|KGN62936.1| (hypothetical protein Csa_2G381380 [Cucumis sativus]) HSP 1 Score: 178.3 bits (451), Expect = 7.4e-42 Identity = 78/111 (70.27%), Postives = 89/111 (80.18%), Query Frame = 1
The following BLAST results are available for this feature:
GO Assignments
This mRNA is annotated with the following GO terms.
This mRNA is a part of the following gene feature(s):
The following polypeptide feature(s) derives from this mRNA:
The following CDS feature(s) are a part of this mRNA:
The following exon feature(s) are a part of this mRNA:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
|