CmoCh04G020820.1 (mRNA) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCTGGCTCAGCAACAGTCGGACAAGTGGGGAATGCTGGGGTAACCCAGAAAAGTGTGGGTTGGGTAGAGCTTGATCTAAATGTTGGCTAGGTAAGCGTCCTGTAGTAAGAGGAGTAGTTATGAACCCTGTAGACGAGAACCCCATGGCGGTGGTGAAGGGAGGGCCCCAATTGGTCGAAAAAGAAAGAATAGTAACTTGGTCCGGACGGAGATGGGGCATACTATTTCTATTCATAAGGGCCCATTTGCCTATTTATATAACGGATCGCCTGGTAGGTCATAAATTGGTAGAATTGGCACCCATTGGGCATTTCTGGGGGCATGTGCAAAATGATAATGGATCTCGTCGGGCATAA ATGGCTGGCTCAGCAACAGTCGGACAAGTGGGGAATGCTGGGGTAACCCAGAAAAGTGTGGGTTGGGTAGAGCTTGATCTAAATCGTCCTGTAGTAAGAGGAGTAGTTATGAACCCTGTAGACGAGAACCCCATGGCGGTGGTGAAGGGAGGGCCCCAATTGGTCGAAAAAGAAAGAATAGTAACTTGGTCCGGACGGAGATGGGGCATACTATTTCTATTCATAAGGGCCCATTTGCCTATTTATATAACGGATCGCCTGGTAGGTCATAAATTGGTAGAATTGGCACCCATTGGGCATTTCTGGGGGCATGTGCAAAATGATAATGGATCTCGTCGGGCATAA ATGGCTGGCTCAGCAACAGTCGGACAAGTGGGGAATGCTGGGGTAACCCAGAAAAGTGTGGGTTGGGTAGAGCTTGATCTAAATCGTCCTGTAGTAAGAGGAGTAGTTATGAACCCTGTAGACGAGAACCCCATGGCGGTGGTGAAGGGAGGGCCCCAATTGGTCGAAAAAGAAAGAATAGTAACTTGGTCCGGACGGAGATGGGGCATACTATTTCTATTCATAAGGGCCCATTTGCCTATTTATATAACGGATCGCCTGGTAGGTCATAAATTGGTAGAATTGGCACCCATTGGGCATTTCTGGGGGCATGTGCAAAATGATAATGGATCTCGTCGGGCATAA
BLAST of CmoCh04G020820.1 vs. Swiss-Prot
Match: RK2_NICDE (50S ribosomal protein L2, chloroplastic OS=Nicotiana debneyi GN=rpl2 PE=3 SV=1) HSP 1 Score: 68.6 bits (166), Expect = 5.2e-11 Identity = 41/60 (68.33%), Postives = 44/60 (73.33%), Query Frame = 1
BLAST of CmoCh04G020820.1 vs. Swiss-Prot
Match: RR19_CUCSA (30S ribosomal protein S19, chloroplastic OS=Cucumis sativus GN=rps19 PE=3 SV=1) HSP 1 Score: 65.5 bits (158), Expect = 4.4e-10 Identity = 37/67 (55.22%), Postives = 43/67 (64.18%), Query Frame = 1
BLAST of CmoCh04G020820.1 vs. Swiss-Prot
Match: RR19_SPIOL (30S ribosomal protein S19 alpha, chloroplastic OS=Spinacia oleracea GN=rps19 PE=1 SV=4) HSP 1 Score: 65.1 bits (157), Expect = 5.7e-10 Identity = 38/67 (56.72%), Postives = 42/67 (62.69%), Query Frame = 1
BLAST of CmoCh04G020820.1 vs. Swiss-Prot
Match: RR19_CARPA (30S ribosomal protein S19, chloroplastic OS=Carica papaya GN=rps19 PE=3 SV=1) HSP 1 Score: 64.3 bits (155), Expect = 9.8e-10 Identity = 36/67 (53.73%), Postives = 42/67 (62.69%), Query Frame = 1
BLAST of CmoCh04G020820.1 vs. Swiss-Prot
Match: RR19_PLAOC (30S ribosomal protein S19, chloroplastic OS=Platanus occidentalis GN=rps19 PE=3 SV=1) HSP 1 Score: 64.3 bits (155), Expect = 9.8e-10 Identity = 37/67 (55.22%), Postives = 42/67 (62.69%), Query Frame = 1
BLAST of CmoCh04G020820.1 vs. TrEMBL
Match: A0A0U1Z6Z7_9CARY (30S ribosomal protein S19, chloroplastic OS=Dianthus longicalyx GN=rps19 PE=3 SV=1) HSP 1 Score: 68.9 bits (167), Expect = 4.4e-09 Identity = 39/67 (58.21%), Postives = 43/67 (64.18%), Query Frame = 1
BLAST of CmoCh04G020820.1 vs. TrEMBL
Match: A0A022PSX7_ERYGU (Uncharacterized protein OS=Erythranthe guttata GN=MIMGU_mgv1a016476mg PE=4 SV=1) HSP 1 Score: 68.6 bits (166), Expect = 5.8e-09 Identity = 42/69 (60.87%), Postives = 45/69 (65.22%), Query Frame = 1
BLAST of CmoCh04G020820.1 vs. TrEMBL
Match: A0A0X9SEX0_LAVAN (30S ribosomal protein S19, chloroplastic OS=Lavandula angustifolia GN=rps19 PE=3 SV=1) HSP 1 Score: 67.4 bits (163), Expect = 1.3e-08 Identity = 41/93 (44.09%), Postives = 54/93 (58.06%), Query Frame = 1
BLAST of CmoCh04G020820.1 vs. TrEMBL
Match: A0A0S2IF65_9ROSI (Ribosomal protein S19 OS=Cucurbita lundelliana GN=rps19 PE=3 SV=1) HSP 1 Score: 67.0 bits (162), Expect = 1.7e-08 Identity = 39/67 (58.21%), Postives = 43/67 (64.18%), Query Frame = 1
BLAST of CmoCh04G020820.1 vs. TrEMBL
Match: A0A0S2IGW4_CUCPE (Ribosomal protein S19 OS=Cucurbita pepo var. texana GN=rps19 PE=3 SV=1) HSP 1 Score: 67.0 bits (162), Expect = 1.7e-08 Identity = 39/67 (58.21%), Postives = 43/67 (64.18%), Query Frame = 1
BLAST of CmoCh04G020820.1 vs. TAIR10
Match: ATCG00820.1 (ATCG00820.1 ribosomal protein S19) HSP 1 Score: 58.2 bits (139), Expect = 4.0e-09 Identity = 38/93 (40.86%), Postives = 51/93 (54.84%), Query Frame = 1
BLAST of CmoCh04G020820.1 vs. TAIR10
Match: ATCG00830.1 (ATCG00830.1 ribosomal protein L2) HSP 1 Score: 53.9 bits (128), Expect = 7.5e-08 Identity = 36/74 (48.65%), Postives = 43/74 (58.11%), Query Frame = 1
BLAST of CmoCh04G020820.1 vs. TAIR10
Match: ATCG01310.1 (ATCG01310.1 ribosomal protein L2) HSP 1 Score: 53.9 bits (128), Expect = 7.5e-08 Identity = 36/74 (48.65%), Postives = 43/74 (58.11%), Query Frame = 1
BLAST of CmoCh04G020820.1 vs. NCBI nr
Match: gi|761631499|gb|AJP62152.1| (ribosomal protein S19 (chloroplast) [Dianthus longicalyx]) HSP 1 Score: 68.9 bits (167), Expect = 6.4e-09 Identity = 39/67 (58.21%), Postives = 43/67 (64.18%), Query Frame = 1
BLAST of CmoCh04G020820.1 vs. NCBI nr
Match: gi|132861|sp|P21434.1|RK2_NICDE (RecName: Full=50S ribosomal protein L2, chloroplastic) HSP 1 Score: 68.6 bits (166), Expect = 8.3e-09 Identity = 41/60 (68.33%), Postives = 44/60 (73.33%), Query Frame = 1
BLAST of CmoCh04G020820.1 vs. NCBI nr
Match: gi|604298921|gb|EYU18891.1| (hypothetical protein MIMGU_mgv1a016476mg [Erythranthe guttata]) HSP 1 Score: 68.6 bits (166), Expect = 8.3e-09 Identity = 42/69 (60.87%), Postives = 45/69 (65.22%), Query Frame = 1
BLAST of CmoCh04G020820.1 vs. NCBI nr
Match: gi|1002161973|ref|YP_009232083.1| (ribosomal protein S19 (chloroplast) [Lavandula angustifolia]) HSP 1 Score: 67.4 bits (163), Expect = 1.8e-08 Identity = 41/93 (44.09%), Postives = 54/93 (58.06%), Query Frame = 1
BLAST of CmoCh04G020820.1 vs. NCBI nr
Match: gi|952954358|gb|ALO21722.1| (ribosomal protein S19 (plastid) [Cucurbita argyrosperma]) HSP 1 Score: 67.0 bits (162), Expect = 2.4e-08 Identity = 39/67 (58.21%), Postives = 43/67 (64.18%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this mRNA:
GO Assignments
This mRNA is annotated with the following GO terms.
This mRNA is a part of the following gene feature(s):
The following polypeptide feature(s) derives from this mRNA:
The following CDS feature(s) are a part of this mRNA:
The following exon feature(s) are a part of this mRNA:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
|