CmoCh04G020770.1 (mRNA) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGAATCCACTGATGTTTGCCGCTTCCGTTATTGCTGCTGGATTGGCCGTCGGGCTTGCTTCTATTGGACCTGGGGTTGGTCAAGGTACTGCTGCGGGCCAAGCTGTAGAAGGGATCGCGAGACAACCCGAGGCGGAGGGAAAAATCCGAGGTACTTTATTGCTTAGTCTGGCTTTTATGGAAGCTTTAACAATTTATGGACTGGTTGTAGCATTAGCACTTTTATTTGCGAATCCTTTTGTTTAA ATGAATCCACTGATGTTTGCCGCTTCCGTTATTGCTGCTGGATTGGCCGTCGGGCTTGCTTCTATTGGACCTGGGGTTGGTCAAGGTACTGCTGCGGGCCAAGCTGTAGAAGGGATCGCGAGACAACCCGAGGCGGAGGGAAAAATCCGAGGTACTTTATTGCTTAGTCTGGCTTTTATGGAAGCTTTAACAATTTATGGACTGGTTGTAGCATTAGCACTTTTATTTGCGAATCCTTTTGTTTAA ATGAATCCACTGATGTTTGCCGCTTCCGTTATTGCTGCTGGATTGGCCGTCGGGCTTGCTTCTATTGGACCTGGGGTTGGTCAAGGTACTGCTGCGGGCCAAGCTGTAGAAGGGATCGCGAGACAACCCGAGGCGGAGGGAAAAATCCGAGGTACTTTATTGCTTAGTCTGGCTTTTATGGAAGCTTTAACAATTTATGGACTGGTTGTAGCATTAGCACTTTTATTTGCGAATCCTTTTGTTTAA
BLAST of CmoCh04G020770.1 vs. Swiss-Prot
Match: ATPH_ATRBE (ATP synthase subunit c, chloroplastic OS=Atropa belladonna GN=atpH PE=3 SV=1) HSP 1 Score: 141.7 bits (356), Expect = 3.4e-33 Identity = 80/81 (98.77%), Postives = 81/81 (100.00%), Query Frame = 1
BLAST of CmoCh04G020770.1 vs. Swiss-Prot
Match: ATPH_ANTFO (ATP synthase subunit c, chloroplastic OS=Anthoceros formosae GN=atpH PE=2 SV=1) HSP 1 Score: 138.7 bits (348), Expect = 2.9e-32 Identity = 79/81 (97.53%), Postives = 80/81 (98.77%), Query Frame = 1
BLAST of CmoCh04G020770.1 vs. Swiss-Prot
Match: ATPH_LOBMA (ATP synthase subunit c, chloroplastic OS=Lobularia maritima GN=atpH PE=3 SV=1) HSP 1 Score: 138.7 bits (348), Expect = 2.9e-32 Identity = 79/81 (97.53%), Postives = 80/81 (98.77%), Query Frame = 1
BLAST of CmoCh04G020770.1 vs. Swiss-Prot
Match: ATPH_POPTR (ATP synthase subunit c, chloroplastic OS=Populus trichocarpa GN=atpH PE=3 SV=1) HSP 1 Score: 138.7 bits (348), Expect = 2.9e-32 Identity = 79/81 (97.53%), Postives = 80/81 (98.77%), Query Frame = 1
BLAST of CmoCh04G020770.1 vs. Swiss-Prot
Match: ATPH_ARAHI (ATP synthase subunit c, chloroplastic OS=Arabis hirsuta GN=atpH PE=3 SV=1) HSP 1 Score: 138.7 bits (348), Expect = 2.9e-32 Identity = 79/81 (97.53%), Postives = 80/81 (98.77%), Query Frame = 1
BLAST of CmoCh04G020770.1 vs. TrEMBL
Match: A0A159BI78_9POAL (ATP synthase CF0 subunit III OS=Urochloa decumbens GN=atpH PE=4 SV=1) HSP 1 Score: 138.7 bits (348), Expect = 3.2e-30 Identity = 79/81 (97.53%), Postives = 80/81 (98.77%), Query Frame = 1
BLAST of CmoCh04G020770.1 vs. TrEMBL
Match: A0A0A8K7Z0_ANACO (ATP synthase subunit c, chloroplastic OS=Ananas comosus GN=atpH PE=3 SV=1) HSP 1 Score: 138.7 bits (348), Expect = 3.2e-30 Identity = 79/81 (97.53%), Postives = 80/81 (98.77%), Query Frame = 1
BLAST of CmoCh04G020770.1 vs. TrEMBL
Match: A0A0K0M136_HELPE (ATP synthase CF0 C subunit OS=Helianthus petiolaris GN=atpH PE=3 SV=1) HSP 1 Score: 138.7 bits (348), Expect = 3.2e-30 Identity = 79/81 (97.53%), Postives = 80/81 (98.77%), Query Frame = 1
BLAST of CmoCh04G020770.1 vs. TrEMBL
Match: A0A142DQA9_9LAMI (ATP synthase subunit c, chloroplastic OS=Stenogyne kanehoana GN=atpH PE=3 SV=1) HSP 1 Score: 138.7 bits (348), Expect = 3.2e-30 Identity = 79/81 (97.53%), Postives = 80/81 (98.77%), Query Frame = 1
BLAST of CmoCh04G020770.1 vs. TrEMBL
Match: T1QQW9_ANGCO (ATP synthase subunit c, chloroplastic OS=Angophora costata GN=atpH PE=3 SV=1) HSP 1 Score: 138.7 bits (348), Expect = 3.2e-30 Identity = 79/81 (97.53%), Postives = 80/81 (98.77%), Query Frame = 1
BLAST of CmoCh04G020770.1 vs. TAIR10
Match: ATCG00140.1 (ATCG00140.1 ATP synthase subunit C family protein) HSP 1 Score: 138.7 bits (348), Expect = 1.6e-33 Identity = 79/81 (97.53%), Postives = 80/81 (98.77%), Query Frame = 1
BLAST of CmoCh04G020770.1 vs. NCBI nr
Match: gi|28261704|ref|NP_783219.1| (ATP synthase CF0 C subunit [Atropa belladonna]) HSP 1 Score: 141.7 bits (356), Expect = 5.5e-31 Identity = 80/81 (98.77%), Postives = 81/81 (100.00%), Query Frame = 1
BLAST of CmoCh04G020770.1 vs. NCBI nr
Match: gi|927371887|ref|YP_009164185.1| (ATP synthase CF0 subunit III (chloroplast) [Viscum minimum]) HSP 1 Score: 138.7 bits (348), Expect = 4.6e-30 Identity = 79/81 (97.53%), Postives = 80/81 (98.77%), Query Frame = 1
BLAST of CmoCh04G020770.1 vs. NCBI nr
Match: gi|757609166|ref|WP_042854983.1| (ATP F0F1 synthase subunit C [Staphylococcus aureus]) HSP 1 Score: 138.7 bits (348), Expect = 4.6e-30 Identity = 79/81 (97.53%), Postives = 80/81 (98.77%), Query Frame = 1
BLAST of CmoCh04G020770.1 vs. NCBI nr
Match: gi|7525020|ref|NP_051046.1| (ATP synthase CF0 C subunit [Arabidopsis thaliana]) HSP 1 Score: 138.7 bits (348), Expect = 4.6e-30 Identity = 79/81 (97.53%), Postives = 80/81 (98.77%), Query Frame = 1
BLAST of CmoCh04G020770.1 vs. NCBI nr
Match: gi|953244968|ref|YP_009180095.1| (ATP synthase CF0 subunit III (chloroplast) [Polygonatum cyrtonema]) HSP 1 Score: 138.7 bits (348), Expect = 4.6e-30 Identity = 79/81 (97.53%), Postives = 80/81 (98.77%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this mRNA:
GO Assignments
This mRNA is annotated with the following GO terms.
This mRNA is a part of the following gene feature(s):
The following polypeptide feature(s) derives from this mRNA:
The following exon feature(s) are a part of this mRNA:
The following CDS feature(s) are a part of this mRNA:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
|