BhiUN316M44 (mRNA) Wax gourd
The following sequences are available for this feature:
Legend: polypeptideCDSexon Hold the cursor over a type above to highlight its positions in the sequence below.GTAGGATTTGATGGGCTTGGTGGAACTGACGAATTCAGCACAGAGGAATTGGAAGATAGATTGGCAAAAAGTCAAGTCATCTTCCATGAAGGTGAATCATCCATAAATGCTTCAAAATCTAGTGCACAAACCAGGAGAAGTGTACGACAAAGTACAAGATCAGACTCATCAGATTCAGAATAA GTAGGATTTGATGGGCTTGGTGGAACTGACGAATTCAGCACAGAGGAATTGGAAGATAGATTGGCAAAAAGTCAAGTCATCTTCCATGAAGGTGAATCATCCATAAATGCTTCAAAATCTAGTGCACAAACCAGGAGAAGTGTACGACAAAGTACAAGATCAGACTCATCAGATTCAGAATAA GTAGGATTTGATGGGCTTGGTGGAACTGACGAATTCAGCACAGAGGAATTGGAAGATAGATTGGCAAAAAGTCAAGTCATCTTCCATGAAGGTGAATCATCCATAAATGCTTCAAAATCTAGTGCACAAACCAGGAGAAGTGTACGACAAAGTACAAGATCAGACTCATCAGATTCAGAATAA VGFDGLGGTDEFSTEELEDRLAKSQVIFHEGESSINASKSSAQTRRSVRQSTRSDSSDSE
BLAST of BhiUN316M44 vs. TAIR10
Match: AT2G18990.1 (thioredoxin domain-containing protein 9 homolog) HSP 1 Score: 65.9 bits (159), Expect = 1.0e-11 Identity = 38/60 (63.33%), Postives = 49/60 (81.67%), Query Frame = 0
BLAST of BhiUN316M44 vs. TAIR10
Match: AT3G25580.1 (Thioredoxin superfamily protein) HSP 1 Score: 65.9 bits (159), Expect = 1.0e-11 Identity = 39/60 (65.00%), Postives = 50/60 (83.33%), Query Frame = 0
BLAST of BhiUN316M44 vs. Swiss-Prot
Match: sp|O64628|TXND9_ARATH (Thioredoxin domain-containing protein 9 homolog OS=Arabidopsis thaliana OX=3702 GN=At2g18990 PE=2 SV=1) HSP 1 Score: 65.9 bits (159), Expect = 1.8e-10 Identity = 38/60 (63.33%), Postives = 49/60 (81.67%), Query Frame = 0
BLAST of BhiUN316M44 vs. TrEMBL
Match: tr|A0A1S3C206|A0A1S3C206_CUCME (thioredoxin domain-containing protein 9 homolog OS=Cucumis melo OX=3656 GN=LOC103495950 PE=4 SV=1) HSP 1 Score: 102.4 bits (254), Expect = 3.5e-19 Identity = 57/60 (95.00%), Postives = 57/60 (95.00%), Query Frame = 0
BLAST of BhiUN316M44 vs. TrEMBL
Match: tr|A0A0A0LT99|A0A0A0LT99_CUCSA (Uncharacterized protein OS=Cucumis sativus OX=3659 GN=Csa_2G418960 PE=4 SV=1) HSP 1 Score: 102.4 bits (254), Expect = 3.5e-19 Identity = 57/60 (95.00%), Postives = 57/60 (95.00%), Query Frame = 0
BLAST of BhiUN316M44 vs. TrEMBL
Match: tr|A0A2P5DN88|A0A2P5DN88_PARAD (Thioredoxin domain-containing protein OS=Parasponia andersonii OX=3476 GN=PanWU01x14_048100 PE=4 SV=1) HSP 1 Score: 93.2 bits (230), Expect = 2.1e-16 Identity = 51/60 (85.00%), Postives = 56/60 (93.33%), Query Frame = 0
BLAST of BhiUN316M44 vs. TrEMBL
Match: tr|A0A2P5EYL3|A0A2P5EYL3_9ROSA (Thioredoxin domain-containing protein OS=Trema orientalis OX=63057 GN=TorRG33x02_136670 PE=4 SV=1) HSP 1 Score: 90.1 bits (222), Expect = 1.8e-15 Identity = 50/60 (83.33%), Postives = 54/60 (90.00%), Query Frame = 0
BLAST of BhiUN316M44 vs. TrEMBL
Match: tr|W9RH59|W9RH59_9ROSA (Thioredoxin domain-containing protein 9-like protein OS=Morus notabilis OX=981085 GN=L484_011499 PE=4 SV=1) HSP 1 Score: 89.0 bits (219), Expect = 4.0e-15 Identity = 49/60 (81.67%), Postives = 54/60 (90.00%), Query Frame = 0
BLAST of BhiUN316M44 vs. NCBI nr
Match: XP_011650010.1 (PREDICTED: thioredoxin domain-containing protein 9 homolog [Cucumis sativus] >KGN63261.1 hypothetical protein Csa_2G418960 [Cucumis sativus]) HSP 1 Score: 102.4 bits (254), Expect = 5.3e-19 Identity = 57/60 (95.00%), Postives = 57/60 (95.00%), Query Frame = 0
BLAST of BhiUN316M44 vs. NCBI nr
Match: XP_008455854.1 (PREDICTED: thioredoxin domain-containing protein 9 homolog [Cucumis melo] >XP_008455855.1 PREDICTED: thioredoxin domain-containing protein 9 homolog [Cucumis melo]) HSP 1 Score: 102.4 bits (254), Expect = 5.3e-19 Identity = 57/60 (95.00%), Postives = 57/60 (95.00%), Query Frame = 0
BLAST of BhiUN316M44 vs. NCBI nr
Match: XP_022944636.1 (thioredoxin domain-containing protein 9 homolog [Cucurbita moschata] >XP_022944637.1 thioredoxin domain-containing protein 9 homolog [Cucurbita moschata] >XP_022944638.1 thioredoxin domain-containing protein 9 homolog [Cucurbita moschata] >XP_022986377.1 thioredoxin domain-containing protein 9 homolog [Cucurbita maxima] >XP_022986378.1 thioredoxin domain-containing protein 9 homolog [Cucurbita maxima] >XP_022986379.1 thioredoxin domain-containing protein 9 homolog [Cucurbita maxima] >XP_022986380.1 thioredoxin domain-containing protein 9 homolog [Cucurbita maxima] >XP_022986381.1 thioredoxin domain-containing protein 9 homolog [Cucurbita maxima]) HSP 1 Score: 99.0 bits (245), Expect = 5.9e-18 Identity = 55/60 (91.67%), Postives = 58/60 (96.67%), Query Frame = 0
BLAST of BhiUN316M44 vs. NCBI nr
Match: XP_023514797.1 (thioredoxin domain-containing protein 9 homolog [Cucurbita pepo subsp. pepo]) HSP 1 Score: 99.0 bits (245), Expect = 5.9e-18 Identity = 55/60 (91.67%), Postives = 58/60 (96.67%), Query Frame = 0
BLAST of BhiUN316M44 vs. NCBI nr
Match: XP_023513333.1 (thioredoxin domain-containing protein 9 homolog [Cucurbita pepo subsp. pepo] >XP_023513334.1 thioredoxin domain-containing protein 9 homolog [Cucurbita pepo subsp. pepo] >XP_023513335.1 thioredoxin domain-containing protein 9 homolog [Cucurbita pepo subsp. pepo]) HSP 1 Score: 97.8 bits (242), Expect = 1.3e-17 Identity = 54/60 (90.00%), Postives = 58/60 (96.67%), Query Frame = 0
The following BLAST results are available for this feature:
GO Assignments
This mRNA is annotated with the following GO terms.
This mRNA is a part of the following gene feature(s):
The following CDS feature(s) are a part of this mRNA:
The following exon feature(s) are a part of this mRNA:
The following polypeptide feature(s) derives from this mRNA:
Analysis Name: InterPro Annotations of wax gourd
Date Performed: 2019-11-17
|