MELO3C020048 (gene) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGACGAGAGAGAGCCGGTAAGAATTGAGGTGTCGGAGATCAGAAGAATAAGAAGCCTTAGTTCATCATTCCGTCGTCAAACATTGAGTTTCCGAAGCAGCTCGGCCGCATCGGTGGAGGAGGAGCATGAGAGGGATACTATAGATCCATCACTTTGGGCAACGGTTGAGAGATTACCGACATTTGAACGGTTGAGATCGTCGTTGTTCGAAGACGTTAGAGGAGTGGAAGTTGATCAGGAGAATGGTGGAAGAAGAGTTGTTGATGTTACTAAGCTTGGAGATGTGGAACGCCATCTTTTTATACAAAGACTCATCAAACACATTGAAAATGATAATCTCAAGCTCTTGACAAAAATTAGAGAGAGAATCCACAAGTAA ATGGACGAGAGAGAGCCGGTAAGAATTGAGGTGTCGGAGATCAGAAGAATAAGAAGCCTTAGTTCATCATTCCGTCGTCAAACATTGAGTTTCCGAAGCAGCTCGGCCGCATCGGTGGAGGAGGAGCATGAGAGGGATACTATAGATCCATCACTTTGGGCAACGGTTGAGAGATTACCGACATTTGAACGGTTGAGATCGTCGTTGTTCGAAGACGTTAGAGGAGTGGAAGTTGATCAGGAGAATGGTGGAAGAAGAGTTGTTGATGTTACTAAGCTTGGAGATGTGGAACGCCATCTTTTTATACAAAGACTCATCAAACACATTGAAAATGATAATCTCAAGCTCTTGACAAAAATTAGAGAGAGAATCCACAAGTAA ATGGACGAGAGAGAGCCGGTAAGAATTGAGGTGTCGGAGATCAGAAGAATAAGAAGCCTTAGTTCATCATTCCGTCGTCAAACATTGAGTTTCCGAAGCAGCTCGGCCGCATCGGTGGAGGAGGAGCATGAGAGGGATACTATAGATCCATCACTTTGGGCAACGGTTGAGAGATTACCGACATTTGAACGGTTGAGATCGTCGTTGTTCGAAGACGTTAGAGGAGTGGAAGTTGATCAGGAGAATGGTGGAAGAAGAGTTGTTGATGTTACTAAGCTTGGAGATGTGGAACGCCATCTTTTTATACAAAGACTCATCAAACACATTGAAAATGATAATCTCAAGCTCTTGACAAAAATTAGAGAGAGAATCCACAAGTAA MDEREPVRIEVSEIRRIRSLSSSFRRQTLSFRSSSAASVEEEHERDTIDPSLWATVERLPTFERLRSSLFEDVRGVEVDQENGGRRVVDVTKLGDVERHLFIQRLIKHIENDNLKLLTKIRERIHK*
BLAST of MELO3C020048 vs. Swiss-Prot
Match: PDR3_TOBAC (Pleiotropic drug resistance protein 3 OS=Nicotiana tabacum GN=PDR3 PE=2 SV=1) HSP 1 Score: 122.9 bits (307), Expect = 2.6e-27 Identity = 68/126 (53.97%), Postives = 92/126 (73.02%), Query Frame = 1
BLAST of MELO3C020048 vs. Swiss-Prot
Match: AB37G_ARATH (ABC transporter G family member 37 OS=Arabidopsis thaliana GN=ABCG37 PE=2 SV=1) HSP 1 Score: 119.0 bits (297), Expect = 3.7e-26 Identity = 74/130 (56.92%), Postives = 89/130 (68.46%), Query Frame = 1
BLAST of MELO3C020048 vs. Swiss-Prot
Match: AB33G_ARATH (ABC transporter G family member 33 OS=Arabidopsis thaliana GN=ABCG33 PE=2 SV=1) HSP 1 Score: 95.5 bits (236), Expect = 4.4e-19 Identity = 53/98 (54.08%), Postives = 66/98 (67.35%), Query Frame = 1
BLAST of MELO3C020048 vs. Swiss-Prot
Match: AB42G_ARATH (ABC transporter G family member 42 OS=Arabidopsis thaliana GN=ABCG42 PE=2 SV=1) HSP 1 Score: 76.6 bits (187), Expect = 2.1e-13 Identity = 45/100 (45.00%), Postives = 61/100 (61.00%), Query Frame = 1
BLAST of MELO3C020048 vs. Swiss-Prot
Match: AB30G_ARATH (ABC transporter G family member 30 OS=Arabidopsis thaliana GN=ABCG30 PE=2 SV=2) HSP 1 Score: 74.7 bits (182), Expect = 8.1e-13 Identity = 44/98 (44.90%), Postives = 57/98 (58.16%), Query Frame = 1
BLAST of MELO3C020048 vs. TrEMBL
Match: A0A0A0KMI3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_5G292220 PE=3 SV=1) HSP 1 Score: 219.5 bits (558), Expect = 2.3e-54 Identity = 115/126 (91.27%), Postives = 118/126 (93.65%), Query Frame = 1
BLAST of MELO3C020048 vs. TrEMBL
Match: V4S2E0_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10013618mg PE=3 SV=1) HSP 1 Score: 126.7 bits (317), Expect = 2.0e-26 Identity = 73/125 (58.40%), Postives = 93/125 (74.40%), Query Frame = 1
BLAST of MELO3C020048 vs. TrEMBL
Match: F6I4H1_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_14s0060g00470 PE=3 SV=1) HSP 1 Score: 125.6 bits (314), Expect = 4.4e-26 Identity = 75/126 (59.52%), Postives = 91/126 (72.22%), Query Frame = 1
BLAST of MELO3C020048 vs. TrEMBL
Match: K4B1D6_SOLLC (Uncharacterized protein OS=Solanum lycopersicum PE=3 SV=1) HSP 1 Score: 123.6 bits (309), Expect = 1.7e-25 Identity = 70/128 (54.69%), Postives = 93/128 (72.66%), Query Frame = 1
BLAST of MELO3C020048 vs. TrEMBL
Match: G3FHD5_SOLTU (ABCG subfamily transporter protein OS=Solanum tuberosum GN=PDR3 PE=2 SV=1) HSP 1 Score: 122.5 bits (306), Expect = 3.8e-25 Identity = 70/128 (54.69%), Postives = 93/128 (72.66%), Query Frame = 1
BLAST of MELO3C020048 vs. TAIR10
Match: AT3G53480.1 (AT3G53480.1 pleiotropic drug resistance 9) HSP 1 Score: 119.0 bits (297), Expect = 2.1e-27 Identity = 74/130 (56.92%), Postives = 89/130 (68.46%), Query Frame = 1
BLAST of MELO3C020048 vs. TAIR10
Match: AT2G37280.1 (AT2G37280.1 pleiotropic drug resistance 5) HSP 1 Score: 95.5 bits (236), Expect = 2.5e-20 Identity = 53/98 (54.08%), Postives = 66/98 (67.35%), Query Frame = 1
BLAST of MELO3C020048 vs. TAIR10
Match: AT4G15233.2 (AT4G15233.2 ABC-2 and Plant PDR ABC-type transporter family protein) HSP 1 Score: 76.6 bits (187), Expect = 1.2e-14 Identity = 45/100 (45.00%), Postives = 61/100 (61.00%), Query Frame = 1
BLAST of MELO3C020048 vs. TAIR10
Match: AT4G15230.1 (AT4G15230.1 pleiotropic drug resistance 2) HSP 1 Score: 74.7 bits (182), Expect = 4.6e-14 Identity = 44/98 (44.90%), Postives = 57/98 (58.16%), Query Frame = 1
BLAST of MELO3C020048 vs. TAIR10
Match: AT4G15215.1 (AT4G15215.1 pleiotropic drug resistance 13) HSP 1 Score: 69.7 bits (169), Expect = 1.5e-12 Identity = 37/74 (50.00%), Postives = 47/74 (63.51%), Query Frame = 1
BLAST of MELO3C020048 vs. NCBI nr
Match: gi|659114007|ref|XP_008456863.1| (PREDICTED: LOW QUALITY PROTEIN: pleiotropic drug resistance protein 3-like [Cucumis melo]) HSP 1 Score: 245.7 bits (626), Expect = 4.2e-62 Identity = 126/126 (100.00%), Postives = 126/126 (100.00%), Query Frame = 1
BLAST of MELO3C020048 vs. NCBI nr
Match: gi|449445399|ref|XP_004140460.1| (PREDICTED: pleiotropic drug resistance protein 3 [Cucumis sativus]) HSP 1 Score: 219.5 bits (558), Expect = 3.2e-54 Identity = 115/126 (91.27%), Postives = 118/126 (93.65%), Query Frame = 1
BLAST of MELO3C020048 vs. NCBI nr
Match: gi|700195688|gb|KGN50865.1| (hypothetical protein Csa_5G292220 [Cucumis sativus]) HSP 1 Score: 219.5 bits (558), Expect = 3.2e-54 Identity = 115/126 (91.27%), Postives = 118/126 (93.65%), Query Frame = 1
BLAST of MELO3C020048 vs. NCBI nr
Match: gi|1009116563|ref|XP_015874840.1| (PREDICTED: pleiotropic drug resistance protein 3-like isoform X2 [Ziziphus jujuba]) HSP 1 Score: 130.2 bits (326), Expect = 2.6e-27 Identity = 76/130 (58.46%), Postives = 91/130 (70.00%), Query Frame = 1
BLAST of MELO3C020048 vs. NCBI nr
Match: gi|1009116561|ref|XP_015874839.1| (PREDICTED: pleiotropic drug resistance protein 3-like isoform X1 [Ziziphus jujuba]) HSP 1 Score: 130.2 bits (326), Expect = 2.6e-27 Identity = 76/130 (58.46%), Postives = 91/130 (70.00%), Query Frame = 1
The following BLAST results are available for this feature:
GO Assignments
This gene is annotated with the following GO terms.
This gene is associated with the following unigenes:
The following mRNA feature(s) are a part of this gene:
The following transcribed_cluster feature(s) are associated with this gene:
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|