MELO3C008590 (gene) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGTGGTTGAACCTGAGGCATACACTTATGATGATGAGGTGATTAAAAAAGCAGAAGCTATGGGTAAAGCTGGATTAGTGGATATTACGGCGAGAGAAGATAGTTTTATCTTCACAGTCGAATCTACAGGTGCAATCAAAGCTTCCCAGTTGATACTCAATGCCATAGATATCCTGAAACAGAAGCTGGATGCCGTCCGTCTTTCAGATGATACCGTAGAAGCAGATGATCAGTTTGGTGAGTTAGGTGCACATATGCGAGGTGGATGA ATGGTGGTTGAACCTGAGGCATACACTTATGATGATGAGGTGATTAAAAAAGCAGAAGCTATGGGTAAAGCTGGATTAGTGGATATTACGGCGAGAGAAGATAGTTTTATCTTCACAGTCGAATCTACAGGTGCAATCAAAGCTTCCCAGTTGATACTCAATGCCATAGATATCCTGAAACAGAAGCTGGATGCCGTCCGTCTTTCAGATGATACCGTAGAAGCAGATGATCAGTTTGGTGAGTTAGGTGCACATATGCGAGGTGGATGA ATGGTGGTTGAACCTGAGGCATACACTTATGATGATGAGGTGATTAAAAAAGCAGAAGCTATGGGTAAAGCTGGATTAGTGGATATTACGGCGAGAGAAGATAGTTTTATCTTCACAGTCGAATCTACAGGTGCAATCAAAGCTTCCCAGTTGATACTCAATGCCATAGATATCCTGAAACAGAAGCTGGATGCCGTCCGTCTTTCAGATGATACCGTAGAAGCAGATGATCAGTTTGGTGAGTTAGGTGCACATATGCGAGGTGGATGA MVVEPEAYTYDDEVIKKAEAMGKAGLVDITAREDSFIFTVESTGAIKASQLILNAIDILKQKLDAVRLSDDTVEADDQFGELGAHMRGG*
BLAST of MELO3C008590 vs. Swiss-Prot
Match: NRPB3_ARATH (DNA-directed RNA polymerases II, IV and V subunit 3 OS=Arabidopsis thaliana GN=NRPB3 PE=1 SV=1) HSP 1 Score: 158.3 bits (399), Expect = 3.9e-38 Identity = 76/89 (85.39%), Postives = 85/89 (95.51%), Query Frame = 1
BLAST of MELO3C008590 vs. Swiss-Prot
Match: RPD3B_ARATH (DNA-directed RNA polymerases IV and V subunit 3B OS=Arabidopsis thaliana GN=NRPD3B PE=1 SV=2) HSP 1 Score: 151.0 bits (380), Expect = 6.3e-36 Identity = 73/89 (82.02%), Postives = 82/89 (92.13%), Query Frame = 1
BLAST of MELO3C008590 vs. Swiss-Prot
Match: RPB3_DICDI (DNA-directed RNA polymerase II subunit rpb3 OS=Dictyostelium discoideum GN=polr2c PE=3 SV=1) HSP 1 Score: 58.2 bits (139), Expect = 5.5e-08 Identity = 29/66 (43.94%), Postives = 41/66 (62.12%), Query Frame = 1
BLAST of MELO3C008590 vs. TrEMBL
Match: A0A0A0LHS1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G093850 PE=4 SV=1) HSP 1 Score: 172.6 bits (436), Expect = 2.2e-40 Identity = 88/89 (98.88%), Postives = 89/89 (100.00%), Query Frame = 1
BLAST of MELO3C008590 vs. TrEMBL
Match: M5W886_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa008812mg PE=4 SV=1) HSP 1 Score: 162.9 bits (411), Expect = 1.8e-37 Identity = 81/89 (91.01%), Postives = 87/89 (97.75%), Query Frame = 1
BLAST of MELO3C008590 vs. TrEMBL
Match: B9HS44_POPTR (DNA-directed RNA polymerase II 36 kDa polypeptide B family protein OS=Populus trichocarpa GN=POPTR_0009s10050g PE=4 SV=2) HSP 1 Score: 161.4 bits (407), Expect = 5.2e-37 Identity = 79/89 (88.76%), Postives = 86/89 (96.63%), Query Frame = 1
BLAST of MELO3C008590 vs. TrEMBL
Match: A0A059BBW8_EUCGR (Uncharacterized protein OS=Eucalyptus grandis GN=EUGRSUZ_G01370 PE=4 SV=1) HSP 1 Score: 160.2 bits (404), Expect = 1.2e-36 Identity = 79/89 (88.76%), Postives = 87/89 (97.75%), Query Frame = 1
BLAST of MELO3C008590 vs. TrEMBL
Match: A0A059WJH0_QUESU (RNA polymerase II OS=Quercus suber PE=2 SV=1) HSP 1 Score: 159.8 bits (403), Expect = 1.5e-36 Identity = 79/89 (88.76%), Postives = 87/89 (97.75%), Query Frame = 1
BLAST of MELO3C008590 vs. TAIR10
Match: AT2G15430.1 (AT2G15430.1 DNA-directed RNA polymerase family protein) HSP 1 Score: 158.3 bits (399), Expect = 2.2e-39 Identity = 76/89 (85.39%), Postives = 85/89 (95.51%), Query Frame = 1
BLAST of MELO3C008590 vs. TAIR10
Match: AT2G15400.1 (AT2G15400.1 DNA-directed RNA polymerase family protein) HSP 1 Score: 151.0 bits (380), Expect = 3.5e-37 Identity = 73/89 (82.02%), Postives = 82/89 (92.13%), Query Frame = 1
BLAST of MELO3C008590 vs. NCBI nr
Match: gi|659082285|ref|XP_008441761.1| (PREDICTED: LOW QUALITY PROTEIN: DNA-directed RNA polymerases II, IV and V subunit 3-like [Cucumis melo]) HSP 1 Score: 173.7 bits (439), Expect = 1.4e-40 Identity = 89/89 (100.00%), Postives = 89/89 (100.00%), Query Frame = 1
BLAST of MELO3C008590 vs. NCBI nr
Match: gi|449442251|ref|XP_004138895.1| (PREDICTED: DNA-directed RNA polymerases II, IV and V subunit 3 [Cucumis sativus]) HSP 1 Score: 172.6 bits (436), Expect = 3.2e-40 Identity = 88/89 (98.88%), Postives = 89/89 (100.00%), Query Frame = 1
BLAST of MELO3C008590 vs. NCBI nr
Match: gi|658063503|ref|XP_008367672.1| (PREDICTED: DNA-directed RNA polymerases II, IV and V subunit 3-like [Malus domestica]) HSP 1 Score: 164.5 bits (415), Expect = 8.8e-38 Identity = 81/89 (91.01%), Postives = 89/89 (100.00%), Query Frame = 1
BLAST of MELO3C008590 vs. NCBI nr
Match: gi|470136511|ref|XP_004304034.1| (PREDICTED: DNA-directed RNA polymerases II, IV and V subunit 3 [Fragaria vesca subsp. vesca]) HSP 1 Score: 164.1 bits (414), Expect = 1.1e-37 Identity = 82/89 (92.13%), Postives = 88/89 (98.88%), Query Frame = 1
BLAST of MELO3C008590 vs. NCBI nr
Match: gi|694413499|ref|XP_009335010.1| (PREDICTED: DNA-directed RNA polymerases II, IV and V subunit 3-like [Pyrus x bretschneideri]) HSP 1 Score: 162.9 bits (411), Expect = 2.6e-37 Identity = 80/89 (89.89%), Postives = 89/89 (100.00%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
This gene is associated with the following unigenes:
The following mRNA feature(s) are a part of this gene:
The following transcribed_cluster feature(s) are associated with this gene:
Analysis Name: InterPro Annotations of melon
Date Performed: 2016-09-28
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|