CsaV3_3G021880 (gene) Cucumber (Chinese Long) v3
The following sequences are available for this feature:
Legend: polypeptideCDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGCTTCACTGCGTTCTCACCGTGCACAGTCATGCACGACGATGTATGCACATCAGCACTCGACAAGATTGCATCCCTTATAATGTTTCCTTTCCATATAACATGGACTTTTATAATACTTTTCCTTTCCATATAACATGGAGTACTTTGGATGGTTATATCAATGAAGACGACAACAAGATTAGGACATTGAACTACAGCGTCCTCGAAAGGGCTCCTGGTTCAGTCGCCATATTGGGCGACCGAGGAAATTTAGGGCGAAAAGGAGTAAAAACGCTGTCAACAAGAATGAGATCTAAATACTCGGTTGTGCATGCATGA ATGCTTCACTGCGTTCTCACCGTGCACAGTCATGCACGACGATGTATGCACATCAGCACTCGACAAGATTGCATCCCTTATAATGTTTCCTTTCCATATAACATGGACTTTTATAATACTTTTCCTTTCCATATAACATGGAGTACTTTGGATGGTTATATCAATGAAGACGACAACAAGATTAGGACATTGAACTACAGCGTCCTCGAAAGGGCTCCTGGTTCAGTCGCCATATTGGGCGACCGAGGAAATTTAGGGCGAAAAGGAGTAAAAACGCTGTCAACAAGAATGAGATCTAAATACTCGGTTGTGCATGCATGA ATGCTTCACTGCGTTCTCACCGTGCACAGTCATGCACGACGATGTATGCACATCAGCACTCGACAAGATTGCATCCCTTATAATGTTTCCTTTCCATATAACATGGACTTTTATAATACTTTTCCTTTCCATATAACATGGAGTACTTTGGATGGTTATATCAATGAAGACGACAACAAGATTAGGACATTGAACTACAGCGTCCTCGAAAGGGCTCCTGGTTCAGTCGCCATATTGGGCGACCGAGGAAATTTAGGGCGAAAAGGAGTAAAAACGCTGTCAACAAGAATGAGATCTAAATACTCGGTTGTGCATGCATGA MLHCVLTVHSHARRCMHISTRQDCIPYNVSFPYNMDFYNTFPFHITWSTLDGYINEDDNKIRTLNYSVLERAPGSVAILGDRGNLGRKGVKTLSTRMRSKYSVVHA
BLAST of CsaV3_3G021880 vs. NCBI nr
Match: KGN57868.1 (hypothetical protein Csa_3G356580 [Cucumis sativus]) HSP 1 Score: 225.7 bits (574), Expect = 7.4e-56 Identity = 106/106 (100.00%), Postives = 106/106 (100.00%), Query Frame = 0
BLAST of CsaV3_3G021880 vs. NCBI nr
Match: XP_023552823.1 (cation/H(+) antiporter 3-like [Cucurbita pepo subsp. pepo]) HSP 1 Score: 74.3 bits (181), Expect = 2.8e-10 Identity = 38/62 (61.29%), Postives = 44/62 (70.97%), Query Frame = 0
BLAST of CsaV3_3G021880 vs. NCBI nr
Match: XP_022922546.1 (cation/H(+) antiporter 12-like [Cucurbita moschata]) HSP 1 Score: 73.2 bits (178), Expect = 6.1e-10 Identity = 37/62 (59.68%), Postives = 44/62 (70.97%), Query Frame = 0
BLAST of CsaV3_3G021880 vs. NCBI nr
Match: XP_022985099.1 (LOW QUALITY PROTEIN: cation/H(+) antiporter 3-like [Cucurbita maxima]) HSP 1 Score: 72.8 bits (177), Expect = 8.0e-10 Identity = 38/62 (61.29%), Postives = 43/62 (69.35%), Query Frame = 0
BLAST of CsaV3_3G021880 vs. NCBI nr
Match: XP_016898962.1 (PREDICTED: cation/H(+) antiporter 10-like [Cucumis melo]) HSP 1 Score: 70.9 bits (172), Expect = 3.1e-09 Identity = 35/62 (56.45%), Postives = 42/62 (67.74%), Query Frame = 0
BLAST of CsaV3_3G021880 vs. TAIR10
Match: AT3G44930.1 (cation/H+ exchanger 10) HSP 1 Score: 48.1 bits (113), Expect = 3.8e-06 Identity = 23/48 (47.92%), Postives = 29/48 (60.42%), Query Frame = 0
BLAST of CsaV3_3G021880 vs. TAIR10
Match: AT3G44920.1 (cation/H+ exchanger 11) HSP 1 Score: 46.2 bits (108), Expect = 1.5e-05 Identity = 23/48 (47.92%), Postives = 27/48 (56.25%), Query Frame = 0
BLAST of CsaV3_3G021880 vs. TAIR10
Match: AT5G22900.1 (cation/H+ exchanger 3) HSP 1 Score: 44.7 bits (104), Expect = 4.2e-05 Identity = 22/51 (43.14%), Postives = 30/51 (58.82%), Query Frame = 0
BLAST of CsaV3_3G021880 vs. TAIR10
Match: AT2G30240.1 (Cation/hydrogen exchanger family protein) HSP 1 Score: 42.7 bits (99), Expect = 1.6e-04 Identity = 24/55 (43.64%), Postives = 35/55 (63.64%), Query Frame = 0
BLAST of CsaV3_3G021880 vs. TAIR10
Match: AT3G44910.1 (cation/H+ exchanger 12) HSP 1 Score: 41.2 bits (95), Expect = 4.7e-04 Identity = 20/43 (46.51%), Postives = 26/43 (60.47%), Query Frame = 0
BLAST of CsaV3_3G021880 vs. Swiss-Prot
Match: sp|Q58P69|CHX10_ARATH (Cation/H(+) antiporter 10 OS=Arabidopsis thaliana OX=3702 GN=CHX10 PE=2 SV=2) HSP 1 Score: 48.1 bits (113), Expect = 6.9e-05 Identity = 23/48 (47.92%), Postives = 29/48 (60.42%), Query Frame = 0
BLAST of CsaV3_3G021880 vs. Swiss-Prot
Match: sp|Q9FYB9|CHX11_ARATH (Cation/H(+) antiporter 11 OS=Arabidopsis thaliana OX=3702 GN=CHX11 PE=2 SV=2) HSP 1 Score: 46.2 bits (108), Expect = 2.6e-04 Identity = 23/48 (47.92%), Postives = 27/48 (56.25%), Query Frame = 0
BLAST of CsaV3_3G021880 vs. Swiss-Prot
Match: sp|Q9FFB8|CHX3_ARATH (Cation/H(+) antiporter 3 OS=Arabidopsis thaliana OX=3702 GN=CHX3 PE=2 SV=1) HSP 1 Score: 44.7 bits (104), Expect = 7.7e-04 Identity = 22/51 (43.14%), Postives = 30/51 (58.82%), Query Frame = 0
BLAST of CsaV3_3G021880 vs. TrEMBL
Match: tr|A0A0A0L7U0|A0A0A0L7U0_CUCSA (Uncharacterized protein OS=Cucumis sativus OX=3659 GN=Csa_3G356580 PE=4 SV=1) HSP 1 Score: 225.7 bits (574), Expect = 4.9e-56 Identity = 106/106 (100.00%), Postives = 106/106 (100.00%), Query Frame = 0
BLAST of CsaV3_3G021880 vs. TrEMBL
Match: tr|A0A1S4DSI7|A0A1S4DSI7_CUCME (cation/H(+) antiporter 10-like OS=Cucumis melo OX=3656 GN=LOC103484220 PE=4 SV=1) HSP 1 Score: 70.9 bits (172), Expect = 2.0e-09 Identity = 35/62 (56.45%), Postives = 42/62 (67.74%), Query Frame = 0
BLAST of CsaV3_3G021880 vs. TrEMBL
Match: tr|A0A0A0LCS1|A0A0A0LCS1_CUCSA (Uncharacterized protein OS=Cucumis sativus OX=3659 GN=Csa_3G355580 PE=4 SV=1) HSP 1 Score: 70.5 bits (171), Expect = 2.6e-09 Identity = 36/62 (58.06%), Postives = 42/62 (67.74%), Query Frame = 0
BLAST of CsaV3_3G021880 vs. TrEMBL
Match: tr|A0A2P6QKH9|A0A2P6QKH9_ROSCH (Putative cation/H+ exchanger OS=Rosa chinensis OX=74649 GN=RchiOBHm_Chr5g0071781 PE=4 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 2.5e-07 Identity = 35/56 (62.50%), Postives = 38/56 (67.86%), Query Frame = 0
BLAST of CsaV3_3G021880 vs. TrEMBL
Match: tr|A0A0A0L7A8|A0A0A0L7A8_CUCSA (Uncharacterized protein OS=Cucumis sativus OX=3659 GN=Csa_3G355570 PE=4 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 3.2e-07 Identity = 32/62 (51.61%), Postives = 45/62 (72.58%), Query Frame = 0
The following BLAST results are available for this feature:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber chineselong genome (v3)
Date Performed: 2019-03-04
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|