CSPI03G22090 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGACTTTTATAATACTTTTCCTTTCCATATAACATGGAGTACTTTGGATGGTTATATCAATGAAGACGACAACAAGATTAGGACATTGAACTACAGCGTCCTCGAAAGGGCTCCTGGTTCAGTCGCCATATTGGGCGACCGAGGAAATTTAGGGCGAAAAGGAGTAAAAACGCTGTCAACAAGAATGAGATCTAAATACTCGGTTGTGCATGCATGA ATGGACTTTTATAATACTTTTCCTTTCCATATAACATGGAGTACTTTGGATGGTTATATCAATGAAGACGACAACAAGATTAGGACATTGAACTACAGCGTCCTCGAAAGGGCTCCTGGTTCAGTCGCCATATTGGGCGACCGAGGAAATTTAGGGCGAAAAGGAGTAAAAACGCTGTCAACAAGAATGAGATCTAAATACTCGGTTGTGCATGCATGA ATGGACTTTTATAATACTTTTCCTTTCCATATAACATGGAGTACTTTGGATGGTTATATCAATGAAGACGACAACAAGATTAGGACATTGAACTACAGCGTCCTCGAAAGGGCTCCTGGTTCAGTCGCCATATTGGGCGACCGAGGAAATTTAGGGCGAAAAGGAGTAAAAACGCTGTCAACAAGAATGAGATCTAAATACTCGGTTGTGCATGCATGA
BLAST of CSPI03G22090 vs. TrEMBL
Match: A0A0A0L7U0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G356580 PE=4 SV=1) HSP 1 Score: 152.1 bits (383), Expect = 2.5e-34 Identity = 72/72 (100.00%), Postives = 72/72 (100.00%), Query Frame = 1
BLAST of CSPI03G22090 vs. TrEMBL
Match: A0A0A0LCS1_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G355580 PE=4 SV=1) HSP 1 Score: 70.9 bits (172), Expect = 7.5e-10 Identity = 36/62 (58.06%), Postives = 42/62 (67.74%), Query Frame = 1
BLAST of CSPI03G22090 vs. TrEMBL
Match: A0A0A0L7A8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G355570 PE=4 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 1.2e-07 Identity = 32/62 (51.61%), Postives = 45/62 (72.58%), Query Frame = 1
BLAST of CSPI03G22090 vs. TrEMBL
Match: M5W3S6_PRUPE (Uncharacterized protein (Fragment) OS=Prunus persica GN=PRUPE_ppa025303mg PE=4 SV=1) HSP 1 Score: 62.4 bits (150), Expect = 2.7e-07 Identity = 31/46 (67.39%), Postives = 35/46 (76.09%), Query Frame = 1
BLAST of CSPI03G22090 vs. TrEMBL
Match: A0A068V9Z2_COFCA (Uncharacterized protein OS=Coffea canephora GN=GSCOC_T00007930001 PE=4 SV=1) HSP 1 Score: 57.8 bits (138), Expect = 6.5e-06 Identity = 28/55 (50.91%), Postives = 37/55 (67.27%), Query Frame = 1
BLAST of CSPI03G22090 vs. TAIR10
Match: AT3G44930.1 (AT3G44930.1 cation/H+ exchanger 10) HSP 1 Score: 48.1 bits (113), Expect = 2.6e-06 Identity = 23/48 (47.92%), Postives = 29/48 (60.42%), Query Frame = 1
BLAST of CSPI03G22090 vs. TAIR10
Match: AT3G44920.1 (AT3G44920.1 cation/H+ exchanger 11) HSP 1 Score: 46.2 bits (108), Expect = 1.0e-05 Identity = 23/48 (47.92%), Postives = 27/48 (56.25%), Query Frame = 1
BLAST of CSPI03G22090 vs. NCBI nr
Match: gi|700202735|gb|KGN57868.1| (hypothetical protein Csa_3G356580 [Cucumis sativus]) HSP 1 Score: 152.1 bits (383), Expect = 3.7e-34 Identity = 72/72 (100.00%), Postives = 72/72 (100.00%), Query Frame = 1
BLAST of CSPI03G22090 vs. NCBI nr
Match: gi|449463487|ref|XP_004149465.1| (PREDICTED: cation/H(+) antiporter 12-like [Cucumis sativus]) HSP 1 Score: 70.9 bits (172), Expect = 1.1e-09 Identity = 36/62 (58.06%), Postives = 42/62 (67.74%), Query Frame = 1
BLAST of CSPI03G22090 vs. NCBI nr
Match: gi|700202732|gb|KGN57865.1| (hypothetical protein Csa_3G355570 [Cucumis sativus]) HSP 1 Score: 63.5 bits (153), Expect = 1.7e-07 Identity = 32/62 (51.61%), Postives = 45/62 (72.58%), Query Frame = 1
BLAST of CSPI03G22090 vs. NCBI nr
Match: gi|449463489|ref|XP_004149466.1| (PREDICTED: cation/H(+) antiporter 4-like [Cucumis sativus]) HSP 1 Score: 63.5 bits (153), Expect = 1.7e-07 Identity = 32/62 (51.61%), Postives = 45/62 (72.58%), Query Frame = 1
BLAST of CSPI03G22090 vs. NCBI nr
Match: gi|645215532|ref|XP_008237001.1| (PREDICTED: cation/H(+) antiporter 4-like [Prunus mume]) HSP 1 Score: 62.4 bits (150), Expect = 3.8e-07 Identity = 31/46 (67.39%), Postives = 35/46 (76.09%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|