CmoCh14G002900 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: exonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGAGAGGCTAAACTCAGAGCTGTACTTGCAGAACTGTTACATAATGAAGGAAAATGAGAGACTGAGGAAGAAAGCTCAACTTTTGAACCAAGAAAATCAAGCACTGCTTTCGGAACTGAAGCAGAAATTATCTAAAGGAAGTTCAAAGGCCAATTCCTCAAAATCAATCCCTGATCTTAATCTCTCCTCTGCAAATCCTTCAAATTCTTCCAACTGA ATGGAGAGGCTAAACTCAGAGCTGTACTTGCAGAACTGTTACATAATGAAGGAAAATGAGAGACTGAGGAAGAAAGCTCAACTTTTGAACCAAGAAAATCAAGCACTGCTTTCGGAACTGAAGCAGAAATTATCTAAAGGAAGTTCAAAGGCCAATTCCTCAAAATCAATCCCTGATCTTAATCTCTCCTCTGCAAATCCTTCAAATTCTTCCAACTGA ATGGAGAGGCTAAACTCAGAGCTGTACTTGCAGAACTGTTACATAATGAAGGAAAATGAGAGACTGAGGAAGAAAGCTCAACTTTTGAACCAAGAAAATCAAGCACTGCTTTCGGAACTGAAGCAGAAATTATCTAAAGGAAGTTCAAAGGCCAATTCCTCAAAATCAATCCCTGATCTTAATCTCTCCTCTGCAAATCCTTCAAATTCTTCCAACTGA
BLAST of CmoCh14G002900 vs. Swiss-Prot
Match: ZPR4_ARATH (Protein LITTLE ZIPPER 4 OS=Arabidopsis thaliana GN=ZPR4 PE=1 SV=1) HSP 1 Score: 77.0 bits (188), Expect = 9.2e-14 Identity = 48/71 (67.61%), Postives = 58/71 (81.69%), Query Frame = 1
BLAST of CmoCh14G002900 vs. Swiss-Prot
Match: ZPR3_ARATH (Protein LITTLE ZIPPER 3 OS=Arabidopsis thaliana GN=ZPR3 PE=1 SV=1) HSP 1 Score: 72.0 bits (175), Expect = 3.0e-12 Identity = 44/66 (66.67%), Postives = 53/66 (80.30%), Query Frame = 1
BLAST of CmoCh14G002900 vs. TrEMBL
Match: A0A0A0LE03_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G776310 PE=4 SV=1) HSP 1 Score: 123.6 bits (309), Expect = 9.6e-26 Identity = 70/72 (97.22%), Postives = 72/72 (100.00%), Query Frame = 1
BLAST of CmoCh14G002900 vs. TrEMBL
Match: V7BHJ4_PHAVU (Uncharacterized protein OS=Phaseolus vulgaris GN=PHAVU_007G229000g PE=4 SV=1) HSP 1 Score: 104.4 bits (259), Expect = 6.0e-20 Identity = 63/75 (84.00%), Postives = 69/75 (92.00%), Query Frame = 1
BLAST of CmoCh14G002900 vs. TrEMBL
Match: A0A067L2W9_JATCU (Uncharacterized protein OS=Jatropha curcas GN=JCGZ_23672 PE=4 SV=1) HSP 1 Score: 102.8 bits (255), Expect = 1.7e-19 Identity = 63/75 (84.00%), Postives = 69/75 (92.00%), Query Frame = 1
BLAST of CmoCh14G002900 vs. TrEMBL
Match: B9SRV7_RICCO (Putative uncharacterized protein OS=Ricinus communis GN=RCOM_0516380 PE=4 SV=1) HSP 1 Score: 100.5 bits (249), Expect = 8.7e-19 Identity = 62/75 (82.67%), Postives = 68/75 (90.67%), Query Frame = 1
BLAST of CmoCh14G002900 vs. TrEMBL
Match: A0A151RIZ1_CAJCA (Uncharacterized protein OS=Cajanus cajan GN=KK1_036033 PE=4 SV=1) HSP 1 Score: 100.1 bits (248), Expect = 1.1e-18 Identity = 60/75 (80.00%), Postives = 69/75 (92.00%), Query Frame = 1
BLAST of CmoCh14G002900 vs. TAIR10
Match: AT3G52770.1 (AT3G52770.1 protein binding) HSP 1 Score: 72.0 bits (175), Expect = 1.7e-13 Identity = 44/66 (66.67%), Postives = 53/66 (80.30%), Query Frame = 1
BLAST of CmoCh14G002900 vs. NCBI nr
Match: gi|659084321|ref|XP_008442826.1| (PREDICTED: uncharacterized protein LOC103486597 [Cucumis melo]) HSP 1 Score: 123.6 bits (309), Expect = 1.4e-25 Identity = 70/72 (97.22%), Postives = 72/72 (100.00%), Query Frame = 1
BLAST of CmoCh14G002900 vs. NCBI nr
Match: gi|1009161201|ref|XP_015898769.1| (PREDICTED: protein LITTLE ZIPPER 3 [Ziziphus jujuba]) HSP 1 Score: 105.5 bits (262), Expect = 3.9e-20 Identity = 62/75 (82.67%), Postives = 70/75 (93.33%), Query Frame = 1
BLAST of CmoCh14G002900 vs. NCBI nr
Match: gi|593689398|ref|XP_007145318.1| (hypothetical protein PHAVU_007G229000g [Phaseolus vulgaris]) HSP 1 Score: 104.4 bits (259), Expect = 8.6e-20 Identity = 63/75 (84.00%), Postives = 69/75 (92.00%), Query Frame = 1
BLAST of CmoCh14G002900 vs. NCBI nr
Match: gi|568856447|ref|XP_006481795.1| (PREDICTED: protein LITTLE ZIPPER 4-like [Citrus sinensis]) HSP 1 Score: 104.4 bits (259), Expect = 8.6e-20 Identity = 61/74 (82.43%), Postives = 67/74 (90.54%), Query Frame = 1
BLAST of CmoCh14G002900 vs. NCBI nr
Match: gi|643736413|gb|KDP42732.1| (hypothetical protein JCGZ_23672 [Jatropha curcas]) HSP 1 Score: 102.8 bits (255), Expect = 2.5e-19 Identity = 63/75 (84.00%), Postives = 69/75 (92.00%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene: |