CmoCh04G020950 (gene) Cucurbita moschata (Rifu)
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGCAATGGAGCAACACCGTGGCCGCGTACGCTCAAGCCTATGCAGAAAAAAGAAAGGGTGACTGCGCCATGATTCACTCAACCGGGCTGTACGGGGAAAACATAGCCGCGGGCTACTACTCTGAGTTCACTGGGGCGGATGCGGTGAAGCTGTGGGTGAACGAGAAGCCGTTGTATGATCATACATCGAATAAATGCGTGGGTGGTTAA ATGCAATGGAGCAACACCGTGGCCGCGTACGCTCAAGCCTATGCAGAAAAAAGAAAGGGTGACTGCGCCATGATTCACTCAACCGGGCTGTACGGGGAAAACATAGCCGCGGGCTACTACTCTGAGTTCACTGGGGCGGATGCGGTGAAGCTGTGGGTGAACGAGAAGCCGTTGTATGATCATACATCGAATAAATGCGTGGGTGGTTAA ATGCAATGGAGCAACACCGTGGCCGCGTACGCTCAAGCCTATGCAGAAAAAAGAAAGGGTGACTGCGCCATGATTCACTCAACCGGGCTGTACGGGGAAAACATAGCCGCGGGCTACTACTCTGAGTTCACTGGGGCGGATGCGGTGAAGCTGTGGGTGAACGAGAAGCCGTTGTATGATCATACATCGAATAAATGCGTGGGTGGTTAA
BLAST of CmoCh04G020950 vs. Swiss-Prot
Match: PRB1_TOBAC (Basic form of pathogenesis-related protein 1 OS=Nicotiana tabacum PE=3 SV=1) HSP 1 Score: 90.5 bits (223), Expect = 7.7e-18 Identity = 41/69 (59.42%), Postives = 49/69 (71.01%), Query Frame = 1
BLAST of CmoCh04G020950 vs. Swiss-Prot
Match: PR1A_TOBAC (Pathogenesis-related protein 1A OS=Nicotiana tabacum PE=1 SV=1) HSP 1 Score: 80.1 bits (196), Expect = 1.0e-14 Identity = 35/69 (50.72%), Postives = 44/69 (63.77%), Query Frame = 1
BLAST of CmoCh04G020950 vs. Swiss-Prot
Match: PR1B_TOBAC (Pathogenesis-related protein 1B OS=Nicotiana tabacum PE=2 SV=1) HSP 1 Score: 80.1 bits (196), Expect = 1.0e-14 Identity = 35/69 (50.72%), Postives = 43/69 (62.32%), Query Frame = 1
BLAST of CmoCh04G020950 vs. Swiss-Prot
Match: PR1A_SOLLC (Pathogenesis-related protein 1A1 OS=Solanum lycopersicum PE=2 SV=1) HSP 1 Score: 78.6 bits (192), Expect = 3.0e-14 Identity = 36/69 (52.17%), Postives = 45/69 (65.22%), Query Frame = 1
BLAST of CmoCh04G020950 vs. Swiss-Prot
Match: PR1C_TOBAC (Pathogenesis-related protein 1C OS=Nicotiana tabacum PE=2 SV=3) HSP 1 Score: 78.2 bits (191), Expect = 4.0e-14 Identity = 35/69 (50.72%), Postives = 43/69 (62.32%), Query Frame = 1
BLAST of CmoCh04G020950 vs. TrEMBL
Match: A0A0A0LLX7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G381130 PE=3 SV=1) HSP 1 Score: 119.0 bits (297), Expect = 2.3e-24 Identity = 52/69 (75.36%), Postives = 57/69 (82.61%), Query Frame = 1
BLAST of CmoCh04G020950 vs. TrEMBL
Match: A0A0A0KHP4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G483242 PE=3 SV=1) HSP 1 Score: 117.1 bits (292), Expect = 8.6e-24 Identity = 51/69 (73.91%), Postives = 56/69 (81.16%), Query Frame = 1
BLAST of CmoCh04G020950 vs. TrEMBL
Match: A0A0A0LSG5_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G381380 PE=3 SV=1) HSP 1 Score: 117.1 bits (292), Expect = 8.6e-24 Identity = 51/69 (73.91%), Postives = 56/69 (81.16%), Query Frame = 1
BLAST of CmoCh04G020950 vs. TrEMBL
Match: A5AD74_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VITISV_019988 PE=3 SV=1) HSP 1 Score: 97.4 bits (241), Expect = 7.0e-18 Identity = 45/69 (65.22%), Postives = 53/69 (76.81%), Query Frame = 1
BLAST of CmoCh04G020950 vs. TrEMBL
Match: D7TY78_VITVI (Putative uncharacterized protein OS=Vitis vinifera GN=VIT_03s0097g00700 PE=3 SV=1) HSP 1 Score: 97.1 bits (240), Expect = 9.2e-18 Identity = 45/69 (65.22%), Postives = 52/69 (75.36%), Query Frame = 1
BLAST of CmoCh04G020950 vs. TAIR10
Match: AT1G50060.1 (AT1G50060.1 CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein) HSP 1 Score: 85.1 bits (209), Expect = 1.8e-17 Identity = 36/67 (53.73%), Postives = 44/67 (65.67%), Query Frame = 1
BLAST of CmoCh04G020950 vs. TAIR10
Match: AT1G50050.1 (AT1G50050.1 CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein) HSP 1 Score: 81.6 bits (200), Expect = 2.0e-16 Identity = 38/67 (56.72%), Postives = 46/67 (68.66%), Query Frame = 1
BLAST of CmoCh04G020950 vs. TAIR10
Match: AT2G14610.1 (AT2G14610.1 pathogenesis-related gene 1) HSP 1 Score: 77.4 bits (189), Expect = 3.8e-15 Identity = 34/68 (50.00%), Postives = 48/68 (70.59%), Query Frame = 1
BLAST of CmoCh04G020950 vs. TAIR10
Match: AT4G33720.1 (AT4G33720.1 CAP (Cysteine-rich secretory proteins, Antigen 5, and Pathogenesis-related 1 protein) superfamily protein) HSP 1 Score: 75.9 bits (185), Expect = 1.1e-14 Identity = 37/66 (56.06%), Postives = 46/66 (69.70%), Query Frame = 1
BLAST of CmoCh04G020950 vs. TAIR10
Match: AT2G14580.1 (AT2G14580.1 basic pathogenesis-related protein 1) HSP 1 Score: 75.5 bits (184), Expect = 1.4e-14 Identity = 34/68 (50.00%), Postives = 45/68 (66.18%), Query Frame = 1
BLAST of CmoCh04G020950 vs. NCBI nr
Match: gi|778674388|ref|XP_004138862.2| (PREDICTED: basic form of pathogenesis-related protein 1-like [Cucumis sativus]) HSP 1 Score: 119.0 bits (297), Expect = 3.2e-24 Identity = 52/69 (75.36%), Postives = 57/69 (82.61%), Query Frame = 1
BLAST of CmoCh04G020950 vs. NCBI nr
Match: gi|700207816|gb|KGN62935.1| (hypothetical protein Csa_2G381130 [Cucumis sativus]) HSP 1 Score: 119.0 bits (297), Expect = 3.2e-24 Identity = 52/69 (75.36%), Postives = 57/69 (82.61%), Query Frame = 1
BLAST of CmoCh04G020950 vs. NCBI nr
Match: gi|778722387|ref|XP_011658476.1| (PREDICTED: basic form of pathogenesis-related protein 1-like [Cucumis sativus]) HSP 1 Score: 117.1 bits (292), Expect = 1.2e-23 Identity = 51/69 (73.91%), Postives = 56/69 (81.16%), Query Frame = 1
BLAST of CmoCh04G020950 vs. NCBI nr
Match: gi|700193135|gb|KGN48339.1| (hypothetical protein Csa_6G483242 [Cucumis sativus]) HSP 1 Score: 117.1 bits (292), Expect = 1.2e-23 Identity = 51/69 (73.91%), Postives = 56/69 (81.16%), Query Frame = 1
BLAST of CmoCh04G020950 vs. NCBI nr
Match: gi|700207817|gb|KGN62936.1| (hypothetical protein Csa_2G381380 [Cucumis sativus]) HSP 1 Score: 117.1 bits (292), Expect = 1.2e-23 Identity = 51/69 (73.91%), Postives = 56/69 (81.16%), Query Frame = 1
The following BLAST results are available for this feature:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita moschata
Date Performed: 2017-05-19
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|