CmaCh11G017340 (gene) Cucurbita maxima (Rimu)
The following sequences are available for this feature:
Legend: CDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGGAAACAATGAAGATCTGCCTCTTTCTCCTCCTCGTCTTCGCCCTCGTTGCTCCGCTCTCCTTTGCCTTCCATGAAACCTCCCACGGTTCATCCCTCGTTGACGATAATTCTGAATATAGCTTCTTTGGTGGAGGCTCCTCCGAAGCCGAAGCCATGACTGAAGATAGTCGCCGACAACTCTTCGAATATGGATTCGCCTATAATAGGGAAGCTCGCAAGAGGTTTTTGACCTACTATGCACTTAGTAAGAATAATATCCCTTGTGGTCGTCGTGGTCACTCCTACTATGATTGCAAGAAGCGTAGAAGGATCAATCCTTATCGTCGTGGTTGTGCTGCCATCACTGGATGTGCTCGATTCACCGATTAA ATGGAAACAATGAAGATCTGCCTCTTTCTCCTCCTCGTCTTCGCCCTCGTTGCTCCGCTCTCCTTTGCCTTCCATGAAACCTCCCACGGTTCATCCCTCGTTGACGATAATTCTGAATATAGCTTCTTTGGTGGAGGCTCCTCCGAAGCCGAAGCCATGACTGAAGATAGTCGCCGACAACTCTTCGAATATGGATTCGCCTATAATAGGGAAGCTCGCAAGAGGTTTTTGACCTACTATGCACTTAGTAAGAATAATATCCCTTGTGGTCGTCGTGGTCACTCCTACTATGATTGCAAGAAGCGTAGAAGGATCAATCCTTATCGTCGTGGTTGTGCTGCCATCACTGGATGTGCTCGATTCACCGATTAA ATGGAAACAATGAAGATCTGCCTCTTTCTCCTCCTCGTCTTCGCCCTCGTTGCTCCGCTCTCCTTTGCCTTCCATGAAACCTCCCACGGTTCATCCCTCGTTGACGATAATTCTGAATATAGCTTCTTTGGTGGAGGCTCCTCCGAAGCCGAAGCCATGACTGAAGATAGTCGCCGACAACTCTTCGAATATGGATTCGCCTATAATAGGGAAGCTCGCAAGAGGTTTTTGACCTACTATGCACTTAGTAAGAATAATATCCCTTGTGGTCGTCGTGGTCACTCCTACTATGATTGCAAGAAGCGTAGAAGGATCAATCCTTATCGTCGTGGTTGTGCTGCCATCACTGGATGTGCTCGATTCACCGATTAA METMKICLFLLLVFALVAPLSFAFHETSHGSSLVDDNSEYSFFGGGSSEAEAMTEDSRRQLFEYGFAYNREARKRFLTYYALSKNNIPCGRRGHSYYDCKKRRRINPYRRGCAAITGCARFTD
BLAST of CmaCh11G017340 vs. Swiss-Prot
Match: RLF19_ARATH (Protein RALF-like 19 OS=Arabidopsis thaliana GN=RALFL19 PE=3 SV=1) HSP 1 Score: 81.3 bits (199), Expect = 8.4e-15 Identity = 39/69 (56.52%), Postives = 48/69 (69.57%), Query Frame = 1
BLAST of CmaCh11G017340 vs. Swiss-Prot
Match: RLF4_ARATH (Protein RALF-like 4 OS=Arabidopsis thaliana GN=RALFL4 PE=3 SV=1) HSP 1 Score: 78.2 bits (191), Expect = 7.1e-14 Identity = 50/125 (40.00%), Postives = 69/125 (55.20%), Query Frame = 1
BLAST of CmaCh11G017340 vs. Swiss-Prot
Match: RLF23_ARATH (Rapid alkalinization factor 23 OS=Arabidopsis thaliana GN=RALF23 PE=1 SV=1) HSP 1 Score: 68.2 bits (165), Expect = 7.3e-11 Identity = 37/81 (45.68%), Postives = 50/81 (61.73%), Query Frame = 1
BLAST of CmaCh11G017340 vs. Swiss-Prot
Match: RALF_TOBAC (Rapid alkalinization factor OS=Nicotiana tabacum GN=RALF PE=1 SV=1) HSP 1 Score: 65.9 bits (159), Expect = 3.6e-10 Identity = 37/79 (46.84%), Postives = 48/79 (60.76%), Query Frame = 1
BLAST of CmaCh11G017340 vs. Swiss-Prot
Match: RLF22_ARATH (Protein RALF-like 22 OS=Arabidopsis thaliana GN=RALFL22 PE=3 SV=1) HSP 1 Score: 64.3 bits (155), Expect = 1.1e-09 Identity = 41/111 (36.94%), Postives = 63/111 (56.76%), Query Frame = 1
BLAST of CmaCh11G017340 vs. TrEMBL
Match: A0A0A0KHU4_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_6G484570 PE=4 SV=1) HSP 1 Score: 115.2 bits (287), Expect = 5.8e-23 Identity = 65/123 (52.85%), Postives = 78/123 (63.41%), Query Frame = 1
BLAST of CmaCh11G017340 vs. TrEMBL
Match: A0A0A0KCD7_CUCSA (F3H9.8 protein OS=Cucumis sativus GN=Csa_6G199790 PE=4 SV=1) HSP 1 Score: 109.0 bits (271), Expect = 4.2e-21 Identity = 62/123 (50.41%), Postives = 79/123 (64.23%), Query Frame = 1
BLAST of CmaCh11G017340 vs. TrEMBL
Match: R0HVQ3_9BRAS (Uncharacterized protein OS=Capsella rubella GN=CARUB_v10024364mg PE=4 SV=1) HSP 1 Score: 84.0 bits (206), Expect = 1.4e-13 Identity = 43/80 (53.75%), Postives = 54/80 (67.50%), Query Frame = 1
BLAST of CmaCh11G017340 vs. TrEMBL
Match: M4EMR1_BRARP (Uncharacterized protein OS=Brassica rapa subsp. pekinensis PE=4 SV=1) HSP 1 Score: 82.8 bits (203), Expect = 3.2e-13 Identity = 43/81 (53.09%), Postives = 53/81 (65.43%), Query Frame = 1
BLAST of CmaCh11G017340 vs. TrEMBL
Match: A0A061GMB1_THECC (Ralf-like 4, putative OS=Theobroma cacao GN=TCM_029845 PE=4 SV=1) HSP 1 Score: 82.8 bits (203), Expect = 3.2e-13 Identity = 48/115 (41.74%), Postives = 69/115 (60.00%), Query Frame = 1
BLAST of CmaCh11G017340 vs. TAIR10
Match: AT2G33775.1 (AT2G33775.1 ralf-like 19) HSP 1 Score: 81.3 bits (199), Expect = 4.7e-16 Identity = 39/69 (56.52%), Postives = 48/69 (69.57%), Query Frame = 1
BLAST of CmaCh11G017340 vs. TAIR10
Match: AT1G28270.1 (AT1G28270.1 ralf-like 4) HSP 1 Score: 78.2 bits (191), Expect = 4.0e-15 Identity = 50/125 (40.00%), Postives = 69/125 (55.20%), Query Frame = 1
BLAST of CmaCh11G017340 vs. TAIR10
Match: AT3G16570.1 (AT3G16570.1 rapid alkalinization factor 23) HSP 1 Score: 68.2 bits (165), Expect = 4.1e-12 Identity = 37/81 (45.68%), Postives = 50/81 (61.73%), Query Frame = 1
BLAST of CmaCh11G017340 vs. TAIR10
Match: AT3G05490.1 (AT3G05490.1 ralf-like 22) HSP 1 Score: 64.3 bits (155), Expect = 6.0e-11 Identity = 41/111 (36.94%), Postives = 63/111 (56.76%), Query Frame = 1
BLAST of CmaCh11G017340 vs. TAIR10
Match: AT4G15800.1 (AT4G15800.1 ralf-like 33) HSP 1 Score: 62.8 bits (151), Expect = 1.7e-10 Identity = 29/61 (47.54%), Postives = 40/61 (65.57%), Query Frame = 1
BLAST of CmaCh11G017340 vs. NCBI nr
Match: gi|449461879|ref|XP_004148669.1| (PREDICTED: protein RALF-like 19 [Cucumis sativus]) HSP 1 Score: 115.2 bits (287), Expect = 8.3e-23 Identity = 65/123 (52.85%), Postives = 78/123 (63.41%), Query Frame = 1
BLAST of CmaCh11G017340 vs. NCBI nr
Match: gi|659080853|ref|XP_008441015.1| (PREDICTED: protein RALF-like 19 [Cucumis melo]) HSP 1 Score: 111.3 bits (277), Expect = 1.2e-21 Identity = 62/124 (50.00%), Postives = 78/124 (62.90%), Query Frame = 1
BLAST of CmaCh11G017340 vs. NCBI nr
Match: gi|449466199|ref|XP_004150814.1| (PREDICTED: protein RALF-like 4 [Cucumis sativus]) HSP 1 Score: 109.0 bits (271), Expect = 6.0e-21 Identity = 62/123 (50.41%), Postives = 79/123 (64.23%), Query Frame = 1
BLAST of CmaCh11G017340 vs. NCBI nr
Match: gi|1009109354|ref|XP_015889777.1| (PREDICTED: protein RALF-like 19 [Ziziphus jujuba]) HSP 1 Score: 92.4 bits (228), Expect = 5.8e-16 Identity = 56/121 (46.28%), Postives = 74/121 (61.16%), Query Frame = 1
BLAST of CmaCh11G017340 vs. NCBI nr
Match: gi|695043794|ref|XP_009409606.1| (PREDICTED: protein RALF-like 22 [Musa acuminata subsp. malaccensis]) HSP 1 Score: 84.3 bits (207), Expect = 1.6e-13 Identity = 38/75 (50.67%), Postives = 51/75 (68.00%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of Cucurbita maxima
Date Performed: 2017-05-20
The following gene(s) are orthologous to this gene: None The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |