Cla97C09G183310 (gene) Watermelon (97103) v2
The following sequences are available for this feature:
Legend: polypeptideCDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGAGTTCGTACGTGGAGGTTGGTCCGGGACAAAACGAAGCCTTGCTCGAAGGTCCAAAAGATGTTGAACTTGGGCGGTGGGAACCGATCGAGCATATCGAAGATCCATACGTGCAAGAGATCGGAAGGTTTGCAGTAATGGAGCACAACAAGCAAACAGGGGCAAACCTAAAGTTCATCCATGTGATAAATGGTGAGAAACAAGTGGTGGCTGGAATAAATTATAGGCTGAGGATTGAAGCAAGGAATGAAATAAATTTGGTTTGGACTTATGAGGCTTTGGTGAATGATAGGCCATGGGAGAAGAAGTGGAAACTCATATATTTTGTACCTCTCCTCAAGAACTGA ATGAGTTCGTACGTGGAGGTTGGTCCGGGACAAAACGAAGCCTTGCTCGAAGGTCCAAAAGATGTTGAACTTGGGCGGTGGGAACCGATCGAGCATATCGAAGATCCATACGTGCAAGAGATCGGAAGGTTTGCAGTAATGGAGCACAACAAGCAAACAGGGGCAAACCTAAAGTTCATCCATGTGATAAATGGTGAGAAACAAGTGGTGGCTGGAATAAATTATAGGCTGAGGATTGAAGCAAGGAATGAAATAAATTTGGTTTGGACTTATGAGGCTTTGGTGAATGATAGGCCATGGGAGAAGAAGTGGAAACTCATATATTTTGTACCTCTCCTCAAGAACTGA ATGAGTTCGTACGTGGAGGTTGGTCCGGGACAAAACGAAGCCTTGCTCGAAGGTCCAAAAGATGTTGAACTTGGGCGGTGGGAACCGATCGAGCATATCGAAGATCCATACGTGCAAGAGATCGGAAGGTTTGCAGTAATGGAGCACAACAAGCAAACAGGGGCAAACCTAAAGTTCATCCATGTGATAAATGGTGAGAAACAAGTGGTGGCTGGAATAAATTATAGGCTGAGGATTGAAGCAAGGAATGAAATAAATTTGGTTTGGACTTATGAGGCTTTGGTGAATGATAGGCCATGGGAGAAGAAGTGGAAACTCATATATTTTGTACCTCTCCTCAAGAACTGA MSSYVEVGPGQNEALLEGPKDVELGRWEPIEHIEDPYVQEIGRFAVMEHNKQTGANLKFIHVINGEKQVVAGINYRLRIEARNEINLVWTYEALVNDRPWEKKWKLIYFVPLLKN
BLAST of Cla97C09G183310 vs. NCBI nr
Match: XP_022936213.1 (cysteine proteinase inhibitor 1-like [Cucurbita moschata]) HSP 1 Score: 138.3 bits (347), Expect = 1.7e-29 Identity = 67/115 (58.26%), Postives = 81/115 (70.43%), Query Frame = 0
BLAST of Cla97C09G183310 vs. NCBI nr
Match: XP_022975710.1 (cysteine proteinase inhibitor 1-like [Cucurbita maxima]) HSP 1 Score: 134.4 bits (337), Expect = 2.4e-28 Identity = 66/115 (57.39%), Postives = 80/115 (69.57%), Query Frame = 0
BLAST of Cla97C09G183310 vs. NCBI nr
Match: XP_022975708.1 (cysteine proteinase inhibitor A-like [Cucurbita maxima]) HSP 1 Score: 117.5 bits (293), Expect = 3.1e-23 Identity = 61/115 (53.04%), Postives = 72/115 (62.61%), Query Frame = 0
BLAST of Cla97C09G183310 vs. NCBI nr
Match: XP_023536176.1 (cysteine proteinase inhibitor A-like [Cucurbita pepo subsp. pepo] >XP_023536178.1 cysteine proteinase inhibitor A-like [Cucurbita pepo subsp. pepo]) HSP 1 Score: 116.7 bits (291), Expect = 5.2e-23 Identity = 61/115 (53.04%), Postives = 72/115 (62.61%), Query Frame = 0
BLAST of Cla97C09G183310 vs. NCBI nr
Match: XP_023536174.1 (cysteine proteinase inhibitor 8-like [Cucurbita pepo subsp. pepo]) HSP 1 Score: 115.5 bits (288), Expect = 1.2e-22 Identity = 59/116 (50.86%), Postives = 76/116 (65.52%), Query Frame = 0
BLAST of Cla97C09G183310 vs. TrEMBL
Match: tr|A0A2I4G446|A0A2I4G446_9ROSI (Cysteine proteinase inhibitor OS=Juglans regia OX=51240 GN=LOC109004561 PE=3 SV=1) HSP 1 Score: 65.9 bits (159), Expect = 7.0e-08 Identity = 35/95 (36.84%), Postives = 53/95 (55.79%), Query Frame = 0
BLAST of Cla97C09G183310 vs. TrEMBL
Match: tr|A0A1B1V5C2|A0A1B1V5C2_OLEEU (Cysteine proteinase inhibitor OS=Olea europaea subsp. europaea OX=158383 PE=2 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 1.2e-07 Identity = 39/102 (38.24%), Postives = 52/102 (50.98%), Query Frame = 0
BLAST of Cla97C09G183310 vs. TrEMBL
Match: tr|D7LFL2|D7LFL2_ARALL (Cysteine proteinase inhibitor OS=Arabidopsis lyrata subsp. lyrata OX=81972 GN=ARALYDRAFT_902339 PE=3 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 1.2e-07 Identity = 32/92 (34.78%), Postives = 47/92 (51.09%), Query Frame = 0
BLAST of Cla97C09G183310 vs. TrEMBL
Match: tr|A0A1D1YNQ2|A0A1D1YNQ2_9ARAE (Cysteine proteinase inhibitor (Fragment) OS=Anthurium amnicola OX=1678845 GN=CYS5 PE=3 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 2.7e-07 Identity = 34/89 (38.20%), Postives = 50/89 (56.18%), Query Frame = 0
BLAST of Cla97C09G183310 vs. TrEMBL
Match: tr|A0A1R3H2Z8|A0A1R3H2Z8_9ROSI (Proteinase inhibitor I25, cystatin OS=Corchorus olitorius OX=93759 GN=COLO4_31900 PE=4 SV=1) HSP 1 Score: 63.9 bits (154), Expect = 2.7e-07 Identity = 34/89 (38.20%), Postives = 46/89 (51.69%), Query Frame = 0
BLAST of Cla97C09G183310 vs. Swiss-Prot
Match: sp|Q41916|CYT5_ARATH (Cysteine proteinase inhibitor 5 OS=Arabidopsis thaliana OX=3702 GN=CYS5 PE=2 SV=2) HSP 1 Score: 59.3 bits (142), Expect = 3.2e-08 Identity = 31/88 (35.23%), Postives = 46/88 (52.27%), Query Frame = 0
BLAST of Cla97C09G183310 vs. Swiss-Prot
Match: sp|Q6TPK4|CYT1_ACTDE (Cysteine proteinase inhibitor 1 OS=Actinidia deliciosa OX=3627 PE=1 SV=1) HSP 1 Score: 58.5 bits (140), Expect = 5.5e-08 Identity = 34/87 (39.08%), Postives = 45/87 (51.72%), Query Frame = 0
BLAST of Cla97C09G183310 vs. Swiss-Prot
Match: sp|Q10Q47|CYT7_ORYSJ (Putative cysteine proteinase inhibitor 7 OS=Oryza sativa subsp. japonica OX=39947 GN=Os03g0210100 PE=3 SV=1) HSP 1 Score: 48.1 bits (113), Expect = 7.4e-05 Identity = 31/96 (32.29%), Postives = 43/96 (44.79%), Query Frame = 0
BLAST of Cla97C09G183310 vs. Swiss-Prot
Match: sp|Q10J94|CYT8_ORYSJ (Cysteine proteinase inhibitor 8 OS=Oryza sativa subsp. japonica OX=39947 GN=Os03g0429000 PE=2 SV=1) HSP 1 Score: 46.2 bits (108), Expect = 2.8e-04 Identity = 25/88 (28.41%), Postives = 40/88 (45.45%), Query Frame = 0
BLAST of Cla97C09G183310 vs. Swiss-Prot
Match: sp|Q10Q46|CYT6_ORYSJ (Cysteine proteinase inhibitor 6 OS=Oryza sativa subsp. japonica OX=39947 GN=Os03g0210200 PE=3 SV=1) HSP 1 Score: 44.7 bits (104), Expect = 8.2e-04 Identity = 29/85 (34.12%), Postives = 45/85 (52.94%), Query Frame = 0
BLAST of Cla97C09G183310 vs. TAIR10
Match: AT5G47550.1 (Cystatin/monellin superfamily protein) HSP 1 Score: 59.3 bits (142), Expect = 1.8e-09 Identity = 31/88 (35.23%), Postives = 46/88 (52.27%), Query Frame = 0
BLAST of Cla97C09G183310 vs. TAIR10
Match: AT4G16500.1 (Cystatin/monellin superfamily protein) HSP 1 Score: 44.3 bits (103), Expect = 6.0e-05 Identity = 23/77 (29.87%), Postives = 39/77 (50.65%), Query Frame = 0
BLAST of Cla97C09G183310 vs. TAIR10
Match: AT2G31980.1 (PHYTOCYSTATIN 2) HSP 1 Score: 42.0 bits (97), Expect = 3.0e-04 Identity = 20/57 (35.09%), Postives = 34/57 (59.65%), Query Frame = 0
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of watermelon 97103 v2
Date Performed: 2019-05-12
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: None |