Cla005574 (gene) Watermelon (97103) v1
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGAGTTCGTACGTGGAGGTTGGTCCGGGACAAAACGAAGCCTTGCTCGAAGGTCCAAAAGATGTTGAACTTGGGCGGTGGGAACCGATCGAGCATATCGAAGATCCATACGTGCAAGAGATCGGAAGGTTTGCAGTAATGGAGCACAACAAGCAAACAGGGGCAAACCTAAAGTTCATCCATGTGATAAATGGTGAGAAACAAGTGGTGGCTGGAATAAATTATAGGCTGAGGATTGAAGCAAGGAATGAAATAAATTTGGTTTGGACTTATGAGGCTTTGGTGAATGATAGGCCATGGGAGAAGAAGTGGAAACTCATATATTTTGTACCTCTCCTCAAGAACTGA ATGAGTTCGTACGTGGAGGTTGGTCCGGGACAAAACGAAGCCTTGCTCGAAGGTCCAAAAGATGTTGAACTTGGGCGGTGGGAACCGATCGAGCATATCGAAGATCCATACGTGCAAGAGATCGGAAGGTTTGCAGTAATGGAGCACAACAAGCAAACAGGGGCAAACCTAAAGTTCATCCATGTGATAAATGGTGAGAAACAAGTGGTGGCTGGAATAAATTATAGGCTGAGGATTGAAGCAAGGAATGAAATAAATTTGGTTTGGACTTATGAGGCTTTGGTGAATGATAGGCCATGGGAGAAGAAGTGGAAACTCATATATTTTGTACCTCTCCTCAAGAACTGA ATGAGTTCGTACGTGGAGGTTGGTCCGGGACAAAACGAAGCCTTGCTCGAAGGTCCAAAAGATGTTGAACTTGGGCGGTGGGAACCGATCGAGCATATCGAAGATCCATACGTGCAAGAGATCGGAAGGTTTGCAGTAATGGAGCACAACAAGCAAACAGGGGCAAACCTAAAGTTCATCCATGTGATAAATGGTGAGAAACAAGTGGTGGCTGGAATAAATTATAGGCTGAGGATTGAAGCAAGGAATGAAATAAATTTGGTTTGGACTTATGAGGCTTTGGTGAATGATAGGCCATGGGAGAAGAAGTGGAAACTCATATATTTTGTACCTCTCCTCAAGAACTGA MSSYVEVGPGQNEALLEGPKDVELGRWEPIEHIEDPYVQEIGRFAVMEHNKQTGANLKFIHVINGEKQVVAGINYRLRIEARNEINLVWTYEALVNDRPWEKKWKLIYFVPLLKN
BLAST of Cla005574 vs. Swiss-Prot
Match: CYT5_ARATH (Cysteine proteinase inhibitor 5 OS=Arabidopsis thaliana GN=CYS5 PE=2 SV=2) HSP 1 Score: 83.6 bits (205), Expect = 1.6e-15 Identity = 41/88 (46.59%), Postives = 55/88 (62.50%), Query Frame = 1
BLAST of Cla005574 vs. Swiss-Prot
Match: CYT1_ACTDE (Cysteine proteinase inhibitor 1 OS=Actinidia deliciosa PE=1 SV=1) HSP 1 Score: 78.2 bits (191), Expect = 6.6e-14 Identity = 41/87 (47.13%), Postives = 53/87 (60.92%), Query Frame = 1
BLAST of Cla005574 vs. Swiss-Prot
Match: CYT7_ORYSJ (Putative cysteine proteinase inhibitor 7 OS=Oryza sativa subsp. japonica GN=Os03g0210100 PE=3 SV=1) HSP 1 Score: 75.5 bits (184), Expect = 4.3e-13 Identity = 44/101 (43.56%), Postives = 61/101 (60.40%), Query Frame = 1
BLAST of Cla005574 vs. Swiss-Prot
Match: CYT6_ORYSJ (Cysteine proteinase inhibitor 6 OS=Oryza sativa subsp. japonica GN=Os03g0210200 PE=3 SV=1) HSP 1 Score: 72.4 bits (176), Expect = 3.6e-12 Identity = 37/85 (43.53%), Postives = 58/85 (68.24%), Query Frame = 1
BLAST of Cla005574 vs. Swiss-Prot
Match: CYT8_ORYSJ (Cysteine proteinase inhibitor 8 OS=Oryza sativa subsp. japonica GN=Os03g0429000 PE=2 SV=1) HSP 1 Score: 70.1 bits (170), Expect = 1.8e-11 Identity = 33/88 (37.50%), Postives = 50/88 (56.82%), Query Frame = 1
BLAST of Cla005574 vs. TrEMBL
Match: D7LFL2_ARALL (Cysteine proteinase inhibitor OS=Arabidopsis lyrata subsp. lyrata GN=ARALYDRAFT_902339 PE=3 SV=1) HSP 1 Score: 89.4 bits (220), Expect = 3.2e-15 Identity = 40/92 (43.48%), Postives = 60/92 (65.22%), Query Frame = 1
BLAST of Cla005574 vs. TrEMBL
Match: R0FZY9_9BRAS (Cysteine proteinase inhibitor OS=Capsella rubella GN=CARUB_v10024940mg PE=3 SV=1) HSP 1 Score: 87.0 bits (214), Expect = 1.6e-14 Identity = 41/93 (44.09%), Postives = 61/93 (65.59%), Query Frame = 1
BLAST of Cla005574 vs. TrEMBL
Match: I3SSB0_MEDTR (Cysteine proteinase inhibitor OS=Medicago truncatula PE=2 SV=1) HSP 1 Score: 85.5 bits (210), Expect = 4.6e-14 Identity = 43/93 (46.24%), Postives = 61/93 (65.59%), Query Frame = 1
BLAST of Cla005574 vs. TrEMBL
Match: G7IM41_MEDTR (Cysteine proteinase inhibitor OS=Medicago truncatula GN=MTR_2g026040 PE=3 SV=1) HSP 1 Score: 85.5 bits (210), Expect = 4.6e-14 Identity = 43/93 (46.24%), Postives = 61/93 (65.59%), Query Frame = 1
BLAST of Cla005574 vs. TrEMBL
Match: V4N3N5_EUTSA (Cysteine proteinase inhibitor OS=Eutrema salsugineum GN=EUTSA_v10001076mg PE=3 SV=1) HSP 1 Score: 85.1 bits (209), Expect = 6.0e-14 Identity = 41/101 (40.59%), Postives = 60/101 (59.41%), Query Frame = 1
BLAST of Cla005574 vs. NCBI nr
Match: gi|297826717|ref|XP_002881241.1| (hypothetical protein ARALYDRAFT_902339 [Arabidopsis lyrata subsp. lyrata]) HSP 1 Score: 89.4 bits (220), Expect = 4.6e-15 Identity = 40/92 (43.48%), Postives = 60/92 (65.22%), Query Frame = 1
BLAST of Cla005574 vs. NCBI nr
Match: gi|720001956|ref|XP_010256520.1| (PREDICTED: cysteine proteinase inhibitor 1-like [Nelumbo nucifera]) HSP 1 Score: 88.2 bits (217), Expect = 1.0e-14 Identity = 42/82 (51.22%), Postives = 56/82 (68.29%), Query Frame = 1
BLAST of Cla005574 vs. NCBI nr
Match: gi|743888071|ref|XP_010910533.1| (PREDICTED: cysteine proteinase inhibitor 1-like [Elaeis guineensis]) HSP 1 Score: 87.4 bits (215), Expect = 1.7e-14 Identity = 44/89 (49.44%), Postives = 60/89 (67.42%), Query Frame = 1
BLAST of Cla005574 vs. NCBI nr
Match: gi|565476347|ref|XP_006295814.1| (hypothetical protein CARUB_v10024940mg [Capsella rubella]) HSP 1 Score: 87.0 bits (214), Expect = 2.3e-14 Identity = 41/93 (44.09%), Postives = 61/93 (65.59%), Query Frame = 1
BLAST of Cla005574 vs. NCBI nr
Match: gi|697150476|ref|XP_009629445.1| (PREDICTED: cysteine proteinase inhibitor 1 {ECO:0000303|PubMed:14697268}-like [Nicotiana tomentosiformis]) HSP 1 Score: 86.7 bits (213), Expect = 3.0e-14 Identity = 49/98 (50.00%), Postives = 61/98 (62.24%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of watermelon (97103)
Date Performed: 2016-09-28
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: None |