Cla97C07G129040 (gene) Watermelon (97103) v2
The following sequences are available for this feature:
Legend: polypeptideexonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCTGAAGAAATTGTTATTCCTTCAGGTTAGTAAGACTTCTCCTTCCCACTTGGGTGTTTTCAAATAATTATTTTTTGTTGTCCTTTTCAGTATTTACATTTTCACCATTCAATTTATTTAGGGAAAAATCCTCGTGGCCCGAACTCGTATTCGTCGAATCTTCCACTGCAGTACATATTATAGAGAGAGAATCCTAAAGTGAAGACAATCGTGCTATTAGCTGGATCTCCAGTTACTGAAGATTTGAGATTTGATCGAGTTCGAGTTTTTGTTAACATAAATAGTGTGGTGGTTATTATTCCTACAATTGGTTGA ATGGCTGAAGAAATTGTTATTCCTTCAGTATTTACATTTTCACCATTCAATTTATTTAGGGAAAAATCCTCGTGGCCCGAACTCGTATTCGTCGAATCTTCCACTGCAAGAGAGAATCCTAAAGTGAAGACAATCGTGCTATTAGCTGGATCTCCAGTTACTGAAGATTTGAGATTTGATCGAGTTCGAGTTTTTGTTAACATAAATAGTGTGGTGGTTATTATTCCTACAATTGGTTGA ATGGCTGAAGAAATTGTTATTCCTTCAGTATTTACATTTTCACCATTCAATTTATTTAGGGAAAAATCCTCGTGGCCCGAACTCGTATTCGTCGAATCTTCCACTGCAAGAGAGAATCCTAAAGTGAAGACAATCGTGCTATTAGCTGGATCTCCAGTTACTGAAGATTTGAGATTTGATCGAGTTCGAGTTTTTGTTAACATAAATAGTGTGGTGGTTATTATTCCTACAATTGGTTGA MAEEIVIPSVFTFSPFNLFREKSSWPELVFVESSTARENPKVKTIVLLAGSPVTEDLRFDRVRVFVNINSVVVIIPTIG
BLAST of Cla97C07G129040 vs. NCBI nr
Match: XP_011654473.1 (PREDICTED: inhibitor of trypsin and hageman factor-like [Cucumis sativus] >KGN49621.1 hypothetical protein Csa_5G027950 [Cucumis sativus]) HSP 1 Score: 77.0 bits (188), Expect = 3.1e-11 Identity = 49/85 (57.65%), Postives = 56/85 (65.88%), Query Frame = 0
BLAST of Cla97C07G129040 vs. NCBI nr
Match: AES61050.1 (inhibitor of trypsin and hageman factor-like protein [Medicago truncatula]) HSP 1 Score: 68.2 bits (165), Expect = 1.5e-08 Identity = 37/63 (58.73%), Postives = 44/63 (69.84%), Query Frame = 0
BLAST of Cla97C07G129040 vs. NCBI nr
Match: XP_020423680.1 (glu S.griseus protease inhibitor [Prunus persica] >ONI26577.1 hypothetical protein PRUPE_1G032100 [Prunus persica]) HSP 1 Score: 65.1 bits (157), Expect = 1.2e-07 Identity = 34/62 (54.84%), Postives = 41/62 (66.13%), Query Frame = 0
BLAST of Cla97C07G129040 vs. NCBI nr
Match: PNX97894.1 (inhibitor of trypsin and hageman factor [Trifolium pratense]) HSP 1 Score: 62.4 bits (150), Expect = 8.0e-07 Identity = 33/68 (48.53%), Postives = 43/68 (63.24%), Query Frame = 0
BLAST of Cla97C07G129040 vs. NCBI nr
Match: KMT10314.1 (hypothetical protein BVRB_5g120650 [Beta vulgaris subsp. vulgaris]) HSP 1 Score: 62.0 bits (149), Expect = 1.0e-06 Identity = 34/65 (52.31%), Postives = 42/65 (64.62%), Query Frame = 0
BLAST of Cla97C07G129040 vs. TrEMBL
Match: tr|A0A0A0KPI0|A0A0A0KPI0_CUCSA (Uncharacterized protein OS=Cucumis sativus OX=3659 GN=Csa_5G027950 PE=4 SV=1) HSP 1 Score: 77.0 bits (188), Expect = 2.1e-11 Identity = 49/85 (57.65%), Postives = 56/85 (65.88%), Query Frame = 0
BLAST of Cla97C07G129040 vs. TrEMBL
Match: tr|G7I4R4|G7I4R4_MEDTR (Inhibitor of trypsin and hageman factor-like protein OS=Medicago truncatula OX=3880 GN=11430529 PE=4 SV=1) HSP 1 Score: 68.2 bits (165), Expect = 9.7e-09 Identity = 37/63 (58.73%), Postives = 44/63 (69.84%), Query Frame = 0
BLAST of Cla97C07G129040 vs. TrEMBL
Match: tr|A0A251QS16|A0A251QS16_PRUPE (Uncharacterized protein OS=Prunus persica OX=3760 GN=PRUPE_1G032100 PE=4 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 8.2e-08 Identity = 34/62 (54.84%), Postives = 41/62 (66.13%), Query Frame = 0
BLAST of Cla97C07G129040 vs. TrEMBL
Match: tr|M5XN51|M5XN51_PRUPE (Uncharacterized protein OS=Prunus persica OX=3760 GN=PRUPE_ppa015379mg PE=4 SV=1) HSP 1 Score: 65.1 bits (157), Expect = 8.2e-08 Identity = 34/62 (54.84%), Postives = 41/62 (66.13%), Query Frame = 0
BLAST of Cla97C07G129040 vs. TrEMBL
Match: tr|A0A1J3DSG5|A0A1J3DSG5_NOCCA (Protease inhibitor HPI (Fragment) OS=Noccaea caerulescens OX=107243 GN=GA_TR19920_c3_g1_i1_g.66185 PE=4 SV=1) HSP 1 Score: 62.4 bits (150), Expect = 5.3e-07 Identity = 33/63 (52.38%), Postives = 41/63 (65.08%), Query Frame = 0
BLAST of Cla97C07G129040 vs. Swiss-Prot
Match: sp|P19873|ITH5_CUCMA (Inhibitor of trypsin and hageman factor OS=Cucurbita maxima OX=3661 PE=1 SV=1) HSP 1 Score: 58.2 bits (139), Expect = 4.9e-08 Identity = 32/63 (50.79%), Postives = 41/63 (65.08%), Query Frame = 0
BLAST of Cla97C07G129040 vs. Swiss-Prot
Match: sp|Q6XNP7|HPI_HEVBR (Protease inhibitor HPI OS=Hevea brasiliensis OX=3981 GN=PI1 PE=1 SV=2) HSP 1 Score: 57.8 bits (138), Expect = 6.5e-08 Identity = 32/63 (50.79%), Postives = 39/63 (61.90%), Query Frame = 0
BLAST of Cla97C07G129040 vs. Swiss-Prot
Match: sp|P24076|BGIA_MOMCH (Glu S.griseus protease inhibitor OS=Momordica charantia OX=3673 PE=1 SV=1) HSP 1 Score: 53.9 bits (128), Expect = 9.3e-07 Identity = 29/63 (46.03%), Postives = 38/63 (60.32%), Query Frame = 0
BLAST of Cla97C07G129040 vs. Swiss-Prot
Match: sp|P20076|IER1_SOLLC (Ethylene-responsive proteinase inhibitor 1 OS=Solanum lycopersicum OX=4081 PE=3 SV=1) HSP 1 Score: 52.8 bits (125), Expect = 2.1e-06 Identity = 30/64 (46.88%), Postives = 40/64 (62.50%), Query Frame = 0
BLAST of Cla97C07G129040 vs. Swiss-Prot
Match: sp|P16231|ICI1_SOLPE (Wound-induced proteinase inhibitor 1 OS=Solanum peruvianum OX=4082 PE=3 SV=1) HSP 1 Score: 52.4 bits (124), Expect = 2.7e-06 Identity = 35/79 (44.30%), Postives = 46/79 (58.23%), Query Frame = 0
BLAST of Cla97C07G129040 vs. TAIR10
Match: AT2G38870.1 (Serine protease inhibitor, potato inhibitor I-type family protein) HSP 1 Score: 56.6 bits (135), Expect = 8.0e-09 Identity = 33/63 (52.38%), Postives = 37/63 (58.73%), Query Frame = 0
BLAST of Cla97C07G129040 vs. TAIR10
Match: AT5G43580.1 (Serine protease inhibitor, potato inhibitor I-type family protein) HSP 1 Score: 48.5 bits (114), Expect = 2.2e-06 Identity = 29/63 (46.03%), Postives = 38/63 (60.32%), Query Frame = 0
BLAST of Cla97C07G129040 vs. TAIR10
Match: AT2G38900.2 (Serine protease inhibitor, potato inhibitor I-type family protein) HSP 1 Score: 41.6 bits (96), Expect = 2.7e-04 Identity = 30/74 (40.54%), Postives = 42/74 (56.76%), Query Frame = 0
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of watermelon 97103 v2
Date Performed: 2019-05-12
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |