Cla97C05G103970 (gene) Watermelon (97103) v2
The following sequences are available for this feature:
Legend: polypeptideexonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGTCCGAAGAATTCTTCAGATTGCTTTATGAAACAGACATAAAATCTAGTGAAGAAAACCTACTTATTGCAATTGTGCCTTTAATGAAGCTTCTCTGCCATGCAGTATTTGGACTAATTCTTGCCCACTCAAACAGAAAACTCATCCCAAAAGCAACATGTAGGTTACTTTCCAAACTTGTTTTTGCCTTGTTCTTGCCCTGCTTGATTTTTACTGAACTGGGCCAAAGTATCACGCTTGAGAGTTTCATTCAGTGGTGGTTTATTCCAGCAAATGTGCTACTCAGCACAGCCATTGGTTGTGCCCTTGGGTATTTGGTTGTTGCTAAATGTCATCCACCCCCTCATACCATACCTCAAATGACAGCATTTGGTTATACTGGAAATCTCTCTCTTGCAGTTGTGGGATCAGTTTGTCACACTGCAATGACCCTTTTGATCCTTCTCATACCATAA ATGTCCGAAGAATTCTTCAGATTGCTTTATGAAACAGACATAAAATCTAGTGAAGAAAACCTACTTATTGCAATTGTGCCTTTAATGAAGCTTCTCTGCCATGCAGTATTTGGACTAATTCTTGCCCACTCAAACAGAAAACTCATCCCAAAAGCAACATGTAGGTTACTTTCCAAACTTGTTTTTGCCTTGTTCTTGCCCTGCTTGATTTTTACTGAACTGGGCCAAAGTATCACGCTTGAGAGTTTCATTCAGTGGTGGTTTATTCCAGCAAATGTGCTACTCAGCACAGCCATTGGTTGTGCCCTTGGGTATTTGGTTGTTGCTAAATGTCATCCACCCCCTCATACCATACCTCAAATGACAGCATTTGGTTATACTGGAAATCTCTCTCTTGCAGTTGTGGGATCAGTTTGTCACACTGCAATGACCCTTTTGATCCTTCTCATACCATAA ATGTCCGAAGAATTCTTCAGATTGCTTTATGAAACAGACATAAAATCTAGTGAAGAAAACCTACTTATTGCAATTGTGCCTTTAATGAAGCTTCTCTGCCATGCAGTATTTGGACTAATTCTTGCCCACTCAAACAGAAAACTCATCCCAAAAGCAACATGTAGGTTACTTTCCAAACTTGTTTTTGCCTTGTTCTTGCCCTGCTTGATTTTTACTGAACTGGGCCAAAGTATCACGCTTGAGAGTTTCATTCAGTGGTGGTTTATTCCAGCAAATGTGCTACTCAGCACAGCCATTGGTTGTGCCCTTGGGTATTTGGTTGTTGCTAAATGTCATCCACCCCCTCATACCATACCTCAAATGACAGCATTTGGTTATACTGGAAATCTCTCTCTTGCAGTTGTGGGATCAGTTTGTCACACTGCAATGACCCTTTTGATCCTTCTCATACCATAA MSEEFFRLLYETDIKSSEENLLIAIVPLMKLLCHAVFGLILAHSNRKLIPKATCRLLSKLVFALFLPCLIFTELGQSITLESFIQWWFIPANVLLSTAIGCALGYLVVAKCHPPPHTIPQMTAFGYTGNLSLAVVGSVCHTAMTLLILLIP
BLAST of Cla97C05G103970 vs. NCBI nr
Match: XP_022945293.1 (protein PIN-LIKES 2-like isoform X1 [Cucurbita moschata] >XP_022945294.1 protein PIN-LIKES 2-like isoform X1 [Cucurbita moschata]) HSP 1 Score: 209.5 bits (532), Expect = 7.8e-51 Identity = 111/141 (78.72%), Postives = 116/141 (82.27%), Query Frame = 0
BLAST of Cla97C05G103970 vs. NCBI nr
Match: XP_022945295.1 (protein PIN-LIKES 2-like isoform X2 [Cucurbita moschata]) HSP 1 Score: 209.5 bits (532), Expect = 7.8e-51 Identity = 111/141 (78.72%), Postives = 116/141 (82.27%), Query Frame = 0
BLAST of Cla97C05G103970 vs. NCBI nr
Match: XP_022968440.1 (protein PIN-LIKES 2-like isoform X1 [Cucurbita maxima] >XP_022968441.1 protein PIN-LIKES 2-like isoform X1 [Cucurbita maxima]) HSP 1 Score: 209.5 bits (532), Expect = 7.8e-51 Identity = 111/141 (78.72%), Postives = 116/141 (82.27%), Query Frame = 0
BLAST of Cla97C05G103970 vs. NCBI nr
Match: XP_022968442.1 (protein PIN-LIKES 2-like isoform X2 [Cucurbita maxima]) HSP 1 Score: 209.5 bits (532), Expect = 7.8e-51 Identity = 111/141 (78.72%), Postives = 116/141 (82.27%), Query Frame = 0
BLAST of Cla97C05G103970 vs. NCBI nr
Match: XP_022968443.1 (protein PIN-LIKES 2-like isoform X3 [Cucurbita maxima]) HSP 1 Score: 209.5 bits (532), Expect = 7.8e-51 Identity = 111/141 (78.72%), Postives = 116/141 (82.27%), Query Frame = 0
BLAST of Cla97C05G103970 vs. TrEMBL
Match: tr|A0A2I4HAJ0|A0A2I4HAJ0_9ROSI (protein PIN-LIKES 2-like OS=Juglans regia OX=51240 GN=LOC109015114 PE=4 SV=1) HSP 1 Score: 183.7 bits (465), Expect = 3.0e-43 Identity = 94/141 (66.67%), Postives = 109/141 (77.30%), Query Frame = 0
BLAST of Cla97C05G103970 vs. TrEMBL
Match: tr|A0A2N9FNQ2|A0A2N9FNQ2_FAGSY (Uncharacterized protein OS=Fagus sylvatica OX=28930 GN=FSB_LOCUS16461 PE=4 SV=1) HSP 1 Score: 182.2 bits (461), Expect = 8.8e-43 Identity = 95/138 (68.84%), Postives = 113/138 (81.88%), Query Frame = 0
BLAST of Cla97C05G103970 vs. TrEMBL
Match: tr|A0A2I4GG82|A0A2I4GG82_9ROSI (protein PIN-LIKES 2-like OS=Juglans regia OX=51240 GN=LOC109007607 PE=4 SV=1) HSP 1 Score: 178.3 bits (451), Expect = 1.3e-41 Identity = 94/138 (68.12%), Postives = 107/138 (77.54%), Query Frame = 0
BLAST of Cla97C05G103970 vs. TrEMBL
Match: tr|A0A2I4HIR0|A0A2I4HIR0_9ROSI (protein PIN-LIKES 2-like OS=Juglans regia OX=51240 GN=LOC109018255 PE=4 SV=1) HSP 1 Score: 178.3 bits (451), Expect = 1.3e-41 Identity = 94/138 (68.12%), Postives = 107/138 (77.54%), Query Frame = 0
BLAST of Cla97C05G103970 vs. TrEMBL
Match: tr|I1N7B8|I1N7B8_SOYBN (Uncharacterized protein OS=Glycine max OX=3847 GN=100795484 PE=4 SV=1) HSP 1 Score: 177.9 bits (450), Expect = 1.7e-41 Identity = 92/137 (67.15%), Postives = 108/137 (78.83%), Query Frame = 0
BLAST of Cla97C05G103970 vs. Swiss-Prot
Match: sp|Q9C999|PILS2_ARATH (Protein PIN-LIKES 2 OS=Arabidopsis thaliana OX=3702 GN=PILS2 PE=2 SV=1) HSP 1 Score: 163.7 bits (413), Expect = 1.6e-39 Identity = 83/133 (62.41%), Postives = 101/133 (75.94%), Query Frame = 0
BLAST of Cla97C05G103970 vs. Swiss-Prot
Match: sp|Q9LZN2|PILS6_ARATH (Protein PIN-LIKES 6 OS=Arabidopsis thaliana OX=3702 GN=PILS6 PE=2 SV=1) HSP 1 Score: 94.7 bits (234), Expect = 9.1e-19 Identity = 48/121 (39.67%), Postives = 77/121 (63.64%), Query Frame = 0
BLAST of Cla97C05G103970 vs. Swiss-Prot
Match: sp|Q9FKY4|PILS7_ARATH (Protein PIN-LIKES 7 OS=Arabidopsis thaliana OX=3702 GN=PILS7 PE=2 SV=1) HSP 1 Score: 84.3 bits (207), Expect = 1.2e-15 Identity = 47/124 (37.90%), Postives = 73/124 (58.87%), Query Frame = 0
BLAST of Cla97C05G103970 vs. Swiss-Prot
Match: sp|Q9SHL8|PILS5_ARATH (Protein PIN-LIKES 5 OS=Arabidopsis thaliana OX=3702 GN=PILS5 PE=2 SV=1) HSP 1 Score: 83.6 bits (205), Expect = 2.1e-15 Identity = 46/122 (37.70%), Postives = 71/122 (58.20%), Query Frame = 0
BLAST of Cla97C05G103970 vs. Swiss-Prot
Match: sp|F4HWB6|PILS1_ARATH (Protein PIN-LIKES 1 OS=Arabidopsis thaliana OX=3702 GN=PILS1 PE=2 SV=1) HSP 1 Score: 71.2 bits (173), Expect = 1.1e-11 Identity = 39/118 (33.05%), Postives = 65/118 (55.08%), Query Frame = 0
BLAST of Cla97C05G103970 vs. TAIR10
Match: AT1G71090.1 (Auxin efflux carrier family protein) HSP 1 Score: 163.7 bits (413), Expect = 8.9e-41 Identity = 83/133 (62.41%), Postives = 101/133 (75.94%), Query Frame = 0
BLAST of Cla97C05G103970 vs. TAIR10
Match: AT5G01990.1 (Auxin efflux carrier family protein) HSP 1 Score: 94.7 bits (234), Expect = 5.1e-20 Identity = 48/121 (39.67%), Postives = 77/121 (63.64%), Query Frame = 0
BLAST of Cla97C05G103970 vs. TAIR10
Match: AT5G65980.1 (Auxin efflux carrier family protein) HSP 1 Score: 84.3 bits (207), Expect = 6.8e-17 Identity = 47/124 (37.90%), Postives = 73/124 (58.87%), Query Frame = 0
BLAST of Cla97C05G103970 vs. TAIR10
Match: AT2G17500.1 (Auxin efflux carrier family protein) HSP 1 Score: 83.6 bits (205), Expect = 1.2e-16 Identity = 46/122 (37.70%), Postives = 71/122 (58.20%), Query Frame = 0
BLAST of Cla97C05G103970 vs. TAIR10
Match: AT1G20925.1 (Auxin efflux carrier family protein) HSP 1 Score: 71.2 bits (173), Expect = 6.0e-13 Identity = 39/118 (33.05%), Postives = 65/118 (55.08%), Query Frame = 0
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of watermelon 97103 v2
Date Performed: 2019-05-12
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene:
|