Carg23520 (gene) Silver-seed gourd
The following sequences are available for this feature:
Legend: polypeptideexonCDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGTCCACTCTCAAGAAAAATAATTTCCATCTCTGGTTCTCAAAGCTCCGCTGCTTTCCGGCCGCCGTGAAACCCTCATCGACGCCGCACATGCCCAACAAAAAACCCCTTTCCATTACCCACCTGGAAAACTCAGACAACTCCTCTACTTCCACCGCTGCTGATGATGGGTTTTTCTCCGACGACTCCACCTCCGATTCCGACGCCGTCCCCGACTTCTCCGCCGCCGTCGCTTCCCATCGTTTCTTCTTCTCCTCACCTGGCTGCTCCAACTCCATTTTCGACTCTTCTCCCGAAACCCATCACGGCGCCGCCGCCGTGCACGGCGGCGTCAAGGTTCGGAAGGTTTCTATAGACCCATTTATCGATTTTAGAGGTTCAATGCAGGAGATGGTCGAAGCAAGAGATCAGCCAGTGGACGTCCGGCGAGACTGGCAGTATCTACAAGAGCTTCTACTCTGTTATCTCCAAATCAACCCCATTGATACCCACAAGTTTATATTAAGAGCTTTCTCCGACCTCGTCGTTTCTTTACTGGAATCATCACCGGAATCACCCTCCAACCACCATCTCCGGCAGCACAATATGAACTCAAACAGCTGGTTAGTCCAATAA ATGTCCACTCTCAAGAAAAATAATTTCCATCTCTGGTTCTCAAAGCTCCGCTGCTTTCCGGCCGCCGTGAAACCCTCATCGACGCCGCACATGCCCAACAAAAAACCCCTTTCCATTACCCACCTGGAAAACTCAGACAACTCCTCTACTTCCACCGCTGCTGATGATGGGTTTTTCTCCGACGACTCCACCTCCGATTCCGACGCCGTCCCCGACTTCTCCGCCGCCGTCGCTTCCCATCGTTTCTTCTTCTCCTCACCTGGCTGCTCCAACTCCATTTTCGACTCTTCTCCCGAAACCCATCACGGCGCCGCCGCCGTGCACGGCGGCGTCAAGGTTCGGAAGGTTTCTATAGACCCATTTATCGATTTTAGAGGTTCAATGCAGGAGATGGTCGAAGCAAGAGATCAGCCAGTGGACGTCCGGCGAGACTGGCAGTATCTACAAGAGCTTCTACTCTGTTATCTCCAAATCAACCCCATTGATACCCACAAGTTTATATTAAGAGCTTTCTCCGACCTCGTCGTTTCTTTACTGGAATCATCACCGGAATCACCCTCCAACCACCATCTCCGGCAGCACAATATGAACTCAAACAGCTGGTTAGTCCAATAA ATGTCCACTCTCAAGAAAAATAATTTCCATCTCTGGTTCTCAAAGCTCCGCTGCTTTCCGGCCGCCGTGAAACCCTCATCGACGCCGCACATGCCCAACAAAAAACCCCTTTCCATTACCCACCTGGAAAACTCAGACAACTCCTCTACTTCCACCGCTGCTGATGATGGGTTTTTCTCCGACGACTCCACCTCCGATTCCGACGCCGTCCCCGACTTCTCCGCCGCCGTCGCTTCCCATCGTTTCTTCTTCTCCTCACCTGGCTGCTCCAACTCCATTTTCGACTCTTCTCCCGAAACCCATCACGGCGCCGCCGCCGTGCACGGCGGCGTCAAGGTTCGGAAGGTTTCTATAGACCCATTTATCGATTTTAGAGGTTCAATGCAGGAGATGGTCGAAGCAAGAGATCAGCCAGTGGACGTCCGGCGAGACTGGCAGTATCTACAAGAGCTTCTACTCTGTTATCTCCAAATCAACCCCATTGATACCCACAAGTTTATATTAAGAGCTTTCTCCGACCTCGTCGTTTCTTTACTGGAATCATCACCGGAATCACCCTCCAACCACCATCTCCGGCAGCACAATATGAACTCAAACAGCTGGTTAGTCCAATAA MSTLKKNNFHLWFSKLRCFPAAVKPSSTPHMPNKKPLSITHLENSDNSSTSTAADDGFFSDDSTSDSDAVPDFSAAVASHRFFFSSPGCSNSIFDSSPETHHGAAAVHGGVKVRKVSIDPFIDFRGSMQEMVEARDQPVDVRRDWQYLQELLLCYLQINPIDTHKFILRAFSDLVVSLLESSPESPSNHHLRQHNMNSNSWLVQ
BLAST of Carg23520 vs. NCBI nr
Match: XP_022956079.1 (transcription repressor OFP12-like [Cucurbita moschata]) HSP 1 Score: 322.0 bits (824), Expect = 1.4e-84 Identity = 179/204 (87.75%), Postives = 179/204 (87.75%), Query Frame = 0
BLAST of Carg23520 vs. NCBI nr
Match: XP_023528062.1 (transcription repressor OFP12-like [Cucurbita pepo subsp. pepo]) HSP 1 Score: 318.9 bits (816), Expect = 1.2e-83 Identity = 201/207 (97.10%), Postives = 201/207 (97.10%), Query Frame = 0
BLAST of Carg23520 vs. NCBI nr
Match: XP_022979427.1 (transcription repressor OFP12-like [Cucurbita maxima]) HSP 1 Score: 266.2 bits (679), Expect = 9.4e-68 Identity = 179/207 (86.47%), Postives = 179/207 (86.47%), Query Frame = 0
BLAST of Carg23520 vs. NCBI nr
Match: XP_008438677.1 (PREDICTED: transcription repressor OFP12-like [Cucumis melo]) HSP 1 Score: 265.0 bits (676), Expect = 2.1e-67 Identity = 136/205 (66.34%), Postives = 149/205 (72.68%), Query Frame = 0
BLAST of Carg23520 vs. NCBI nr
Match: KGN56982.1 (hypothetical protein Csa_3G146670 [Cucumis sativus]) HSP 1 Score: 261.9 bits (668), Expect = 1.8e-66 Identity = 170/205 (82.93%), Postives = 182/205 (88.78%), Query Frame = 0
BLAST of Carg23520 vs. TAIR10
Match: AT1G05420.1 (ovate family protein 12) HSP 1 Score: 84.7 bits (208), Expect = 7.1e-17 Identity = 50/100 (50.00%), Postives = 66/100 (66.00%), Query Frame = 0
BLAST of Carg23520 vs. TAIR10
Match: AT4G14860.1 (ovate family protein 11) HSP 1 Score: 77.0 bits (188), Expect = 1.5e-14 Identity = 41/77 (53.25%), Postives = 51/77 (66.23%), Query Frame = 0
BLAST of Carg23520 vs. TAIR10
Match: AT2G32100.1 (ovate family protein 16) HSP 1 Score: 74.7 bits (182), Expect = 7.3e-14 Identity = 37/67 (55.22%), Postives = 48/67 (71.64%), Query Frame = 0
BLAST of Carg23520 vs. TAIR10
Match: AT1G79960.1 (ovate family protein 14) HSP 1 Score: 64.7 bits (156), Expect = 7.6e-11 Identity = 32/82 (39.02%), Postives = 48/82 (58.54%), Query Frame = 0
BLAST of Carg23520 vs. TAIR10
Match: AT2G36050.1 (ovate family protein 15) HSP 1 Score: 57.8 bits (138), Expect = 9.2e-09 Identity = 33/104 (31.73%), Postives = 58/104 (55.77%), Query Frame = 0
BLAST of Carg23520 vs. Swiss-Prot
Match: sp|F4I8R6|OFP12_ARATH (Transcription repressor OFP12 OS=Arabidopsis thaliana OX=3702 GN=OFP12 PE=1 SV=1) HSP 1 Score: 84.7 bits (208), Expect = 1.3e-15 Identity = 50/100 (50.00%), Postives = 66/100 (66.00%), Query Frame = 0
BLAST of Carg23520 vs. Swiss-Prot
Match: sp|O23341|OFP11_ARATH (Transcription repressor OFP11 OS=Arabidopsis thaliana OX=3702 GN=OFP11 PE=2 SV=1) HSP 1 Score: 77.0 bits (188), Expect = 2.7e-13 Identity = 41/77 (53.25%), Postives = 51/77 (66.23%), Query Frame = 0
BLAST of Carg23520 vs. Swiss-Prot
Match: sp|Q9SKY9|OFP16_ARATH (Transcription repressor OFP16 OS=Arabidopsis thaliana OX=3702 GN=OFP16 PE=2 SV=1) HSP 1 Score: 74.7 bits (182), Expect = 1.3e-12 Identity = 37/67 (55.22%), Postives = 48/67 (71.64%), Query Frame = 0
BLAST of Carg23520 vs. Swiss-Prot
Match: sp|Q9S7T5|OFP14_ARATH (Transcription repressor OFP14 OS=Arabidopsis thaliana OX=3702 GN=OFP14 PE=1 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 1.4e-09 Identity = 32/82 (39.02%), Postives = 48/82 (58.54%), Query Frame = 0
BLAST of Carg23520 vs. Swiss-Prot
Match: sp|Q9SJ45|OPF15_ARATH (Transcription repressor OFP15 OS=Arabidopsis thaliana OX=3702 GN=OFP15 PE=1 SV=1) HSP 1 Score: 57.8 bits (138), Expect = 1.7e-07 Identity = 33/104 (31.73%), Postives = 58/104 (55.77%), Query Frame = 0
BLAST of Carg23520 vs. TrEMBL
Match: tr|A0A1S3AXN5|A0A1S3AXN5_CUCME (transcription repressor OFP12-like OS=Cucumis melo OX=3656 GN=LOC103483710 PE=4 SV=1) HSP 1 Score: 265.0 bits (676), Expect = 1.4e-67 Identity = 136/205 (66.34%), Postives = 149/205 (72.68%), Query Frame = 0
BLAST of Carg23520 vs. TrEMBL
Match: tr|A0A0A0L8Q1|A0A0A0L8Q1_CUCSA (Uncharacterized protein OS=Cucumis sativus OX=3659 GN=Csa_3G146670 PE=4 SV=1) HSP 1 Score: 261.9 bits (668), Expect = 1.2e-66 Identity = 170/205 (82.93%), Postives = 182/205 (88.78%), Query Frame = 0
BLAST of Carg23520 vs. TrEMBL
Match: tr|A0A1R3ISZ9|A0A1R3ISZ9_9ROSI (Uncharacterized protein OS=Corchorus olitorius OX=93759 GN=COLO4_21485 PE=4 SV=1) HSP 1 Score: 117.9 bits (294), Expect = 2.7e-23 Identity = 65/126 (51.59%), Postives = 83/126 (65.87%), Query Frame = 0
BLAST of Carg23520 vs. TrEMBL
Match: tr|N1NJM5|N1NJM5_ARAHY (Uncharacterized protein OS=Arachis hypogaea OX=3818 GN=ARAX_AHF417E07-002 PE=4 SV=1) HSP 1 Score: 117.1 bits (292), Expect = 4.7e-23 Identity = 59/107 (55.14%), Postives = 76/107 (71.03%), Query Frame = 0
BLAST of Carg23520 vs. TrEMBL
Match: tr|A0A2I4G8Z1|A0A2I4G8Z1_9ROSI (transcription repressor OFP12-like OS=Juglans regia OX=51240 GN=LOC109005775 PE=4 SV=1) HSP 1 Score: 116.7 bits (291), Expect = 6.1e-23 Identity = 66/132 (50.00%), Postives = 84/132 (63.64%), Query Frame = 0
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of silver-seed gourd
Date Performed: 2019-03-07
The following gene(s) are orthologous to this gene: The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene:
|