Carg20021 (gene) Silver-seed gourd
The following sequences are available for this feature:
Legend: polypeptideCDSexon Hold the cursor over a type above to highlight its positions in the sequence below.ATGCCTTGCCTTTACATCTCCACCAACGTCGATCTCGCCGGAGCCGACTCCGCCGCCATCTTCGCCGCCACAACCTCCGCCGTCTCCTCAATTATAGGCAAACCCGAGAATGTAAACCATACTCTCTCTCTCTATATATATATAATATTGATATTTGTCTTCCATTACAGCTTACCGATGCATTGGTTTTAGTAAATATTCTTAATTTATTTTGTTTTTTTTTGGACAGTATGTTATGGTGTTGTTGAAAGGGTCGGTGGCGATATCGTTCGGGGGGAACAAGGAACCGGCGGCGTTTGCGGAGGTGGTGTCGATGGGAGGAATAAACTCAGAAGTAAAGAGGCGGCTGATCGCCACGATTGGAAGCATTTTGAAGGAGAAGCTGTCAGTTCCGCCGGCGAGATTCTTCCTTAAAGTCCACGACACGACGGCGGGTCGCCCCGTTTCAAAATTATGA ATGCCTTGCCTTTACATCTCCACCAACGTCGATCTCGCCGGAGCCGACTCCGCCGCCATCTTCGCCGCCACAACCTCCGCCGTCTCCTCAATTATAGGCAAACCCGAGAATTATGTTATGGTGTTGTTGAAAGGGTCGGTGGCGATATCGTTCGGGGGGAACAAGGAACCGGCGGCGTTTGCGGAGGTGGTGTCGATGGGAGGAATAAACTCAGAAGTAAAGAGGCGGCTGATCGCCACGATTGGAAGCATTTTGAAGGAGAAGCTGTCAGTTCCGCCGGCGAGATTCTTCCTTAAAGTCCACGACACGACGGCGGGTCGCCCCGTTTCAAAATTATGA ATGCCTTGCCTTTACATCTCCACCAACGTCGATCTCGCCGGAGCCGACTCCGCCGCCATCTTCGCCGCCACAACCTCCGCCGTCTCCTCAATTATAGGCAAACCCGAGAATTATGTTATGGTGTTGTTGAAAGGGTCGGTGGCGATATCGTTCGGGGGGAACAAGGAACCGGCGGCGTTTGCGGAGGTGGTGTCGATGGGAGGAATAAACTCAGAAGTAAAGAGGCGGCTGATCGCCACGATTGGAAGCATTTTGAAGGAGAAGCTGTCAGTTCCGCCGGCGAGATTCTTCCTTAAAGTCCACGACACGACGGCGGGTCGCCCCGTTTCAAAATTATGA MPCLYISTNVDLAGADSAAIFAATTSAVSSIIGKPENYVMVLLKGSVAISFGGNKEPAAFAEVVSMGGINSEVKRRLIATIGSILKEKLSVPPARFFLKVHDTTAGRPVSKL
BLAST of Carg20021 vs. NCBI nr
Match: XP_022949815.1 (macrophage migration inhibitory factor homolog [Cucurbita moschata] >XP_023543101.1 macrophage migration inhibitory factor homolog [Cucurbita pepo subsp. pepo]) HSP 1 Score: 213.0 bits (541), Expect = 5.2e-52 Identity = 112/112 (100.00%), Postives = 112/112 (100.00%), Query Frame = 0
BLAST of Carg20021 vs. NCBI nr
Match: XP_022978322.1 (macrophage migration inhibitory factor homolog [Cucurbita maxima]) HSP 1 Score: 210.3 bits (534), Expect = 3.4e-51 Identity = 111/112 (99.11%), Postives = 111/112 (99.11%), Query Frame = 0
BLAST of Carg20021 vs. NCBI nr
Match: XP_022144090.1 (macrophage migration inhibitory factor homolog [Momordica charantia]) HSP 1 Score: 194.1 bits (492), Expect = 2.5e-46 Identity = 99/112 (88.39%), Postives = 108/112 (96.43%), Query Frame = 0
BLAST of Carg20021 vs. NCBI nr
Match: XP_008464238.1 (PREDICTED: macrophage migration inhibitory factor homolog [Cucumis melo]) HSP 1 Score: 193.7 bits (491), Expect = 3.3e-46 Identity = 99/112 (88.39%), Postives = 106/112 (94.64%), Query Frame = 0
BLAST of Carg20021 vs. NCBI nr
Match: XP_004148599.1 (PREDICTED: macrophage migration inhibitory factor homolog [Cucumis sativus] >KGN54417.1 hypothetical protein Csa_4G314440 [Cucumis sativus]) HSP 1 Score: 193.4 bits (490), Expect = 4.3e-46 Identity = 99/112 (88.39%), Postives = 106/112 (94.64%), Query Frame = 0
BLAST of Carg20021 vs. TAIR10
Match: AT5G01650.2 (Tautomerase/MIF superfamily protein) HSP 1 Score: 126.3 bits (316), Expect = 1.2e-29 Identity = 59/103 (57.28%), Postives = 85/103 (82.52%), Query Frame = 0
BLAST of Carg20021 vs. TAIR10
Match: AT3G51660.1 (Tautomerase/MIF superfamily protein) HSP 1 Score: 124.4 bits (311), Expect = 4.4e-29 Identity = 64/112 (57.14%), Postives = 81/112 (72.32%), Query Frame = 0
BLAST of Carg20021 vs. TAIR10
Match: AT5G57170.2 (Tautomerase/MIF superfamily protein) HSP 1 Score: 90.5 bits (223), Expect = 7.1e-19 Identity = 49/112 (43.75%), Postives = 71/112 (63.39%), Query Frame = 0
BLAST of Carg20021 vs. Swiss-Prot
Match: sp|P81748|MIFH_TRITR (Macrophage migration inhibitory factor homolog OS=Trichuris trichiura OX=36087 PE=1 SV=2) HSP 1 Score: 60.1 bits (144), Expect = 1.8e-08 Identity = 34/102 (33.33%), Postives = 53/102 (51.96%), Query Frame = 0
BLAST of Carg20021 vs. Swiss-Prot
Match: sp|P81529|MIFH_TRISP (Macrophage migration inhibitory factor homolog OS=Trichinella spiralis OX=6334 PE=1 SV=2) HSP 1 Score: 55.8 bits (133), Expect = 3.5e-07 Identity = 35/99 (35.35%), Postives = 56/99 (56.57%), Query Frame = 0
BLAST of Carg20021 vs. Swiss-Prot
Match: sp|P91850|MIFH_BRUMA (Macrophage migration inhibitory factor homolog OS=Brugia malayi OX=6279 GN=Bm1_28435 PE=3 SV=4) HSP 1 Score: 53.1 bits (126), Expect = 2.3e-06 Identity = 30/105 (28.57%), Postives = 56/105 (53.33%), Query Frame = 0
BLAST of Carg20021 vs. Swiss-Prot
Match: sp|P80177|MIF_BOVIN (Macrophage migration inhibitory factor OS=Bos taurus OX=9913 GN=MIF PE=1 SV=6) HSP 1 Score: 48.5 bits (114), Expect = 5.6e-05 Identity = 29/105 (27.62%), Postives = 48/105 (45.71%), Query Frame = 0
BLAST of Carg20021 vs. Swiss-Prot
Match: sp|Q1ZZU7|MIF_SHEEP (Macrophage migration inhibitory factor OS=Ovis aries OX=9940 GN=MIF PE=3 SV=1) HSP 1 Score: 48.5 bits (114), Expect = 5.6e-05 Identity = 29/105 (27.62%), Postives = 48/105 (45.71%), Query Frame = 0
BLAST of Carg20021 vs. TrEMBL
Match: tr|A0A1S3CL09|A0A1S3CL09_CUCME (macrophage migration inhibitory factor homolog OS=Cucumis melo OX=3656 GN=LOC103502168 PE=4 SV=1) HSP 1 Score: 193.7 bits (491), Expect = 2.2e-46 Identity = 99/112 (88.39%), Postives = 106/112 (94.64%), Query Frame = 0
BLAST of Carg20021 vs. TrEMBL
Match: tr|A0A0A0L1F7|A0A0A0L1F7_CUCSA (Uncharacterized protein OS=Cucumis sativus OX=3659 GN=Csa_4G314440 PE=4 SV=1) HSP 1 Score: 193.4 bits (490), Expect = 2.8e-46 Identity = 99/112 (88.39%), Postives = 106/112 (94.64%), Query Frame = 0
BLAST of Carg20021 vs. TrEMBL
Match: tr|A0A059A6Q7|A0A059A6Q7_EUCGR (Uncharacterized protein OS=Eucalyptus grandis OX=71139 GN=EUGRSUZ_K02948 PE=4 SV=1) HSP 1 Score: 166.0 bits (419), Expect = 4.8e-38 Identity = 83/112 (74.11%), Postives = 100/112 (89.29%), Query Frame = 0
BLAST of Carg20021 vs. TrEMBL
Match: tr|A0A2I4H5E2|A0A2I4H5E2_9ROSI (macrophage migration inhibitory factor homolog OS=Juglans regia OX=51240 GN=LOC109013656 PE=4 SV=1) HSP 1 Score: 160.6 bits (405), Expect = 2.0e-36 Identity = 80/112 (71.43%), Postives = 95/112 (84.82%), Query Frame = 0
BLAST of Carg20021 vs. TrEMBL
Match: tr|D7SR56|D7SR56_VITVI (Uncharacterized protein OS=Vitis vinifera OX=29760 GN=VIT_08s0058g00590 PE=4 SV=1) HSP 1 Score: 160.6 bits (405), Expect = 2.0e-36 Identity = 82/112 (73.21%), Postives = 96/112 (85.71%), Query Frame = 0
The following BLAST results are available for this feature:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of silver-seed gourd
Date Performed: 2019-03-07
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |