CSPI07G12480 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: five_prime_UTRCDS Hold the cursor over a type above to highlight its positions in the sequence below.AGAACGACTATTCTGAACAATGGGCCCTTGCATGTGGGGAGATTCTGCGAATCTTGACTCATTACAATCGCCCGATATACAAGATGGAACGAAAAAATGGTGAAACAGAAAGAAGCAGTAGTGGCAGCCTTGCCACGACAAGTGACACCGATGATAGGGAACTTGTTGGAATGCCTCAGCAACAAGAGAGGAAACCTGTACGACCTTTGTCCCCCTGGATTACTGATATATTGCTTGCTGCACCATTGGGCATCAGAAGTGACTATTTCCGCTGGTAA ATGGAACGAAAAAATGGTGAAACAGAAAGAAGCAGTAGTGGCAGCCTTGCCACGACAAGTGACACCGATGATAGGGAACTTGTTGGAATGCCTCAGCAACAAGAGAGGAAACCTGTACGACCTTTGTCCCCCTGGATTACTGATATATTGCTTGCTGCACCATTGGGCATCAGAAGTGACTATTTCCGCTGGTAA ATGGAACGAAAAAATGGTGAAACAGAAAGAAGCAGTAGTGGCAGCCTTGCCACGACAAGTGACACCGATGATAGGGAACTTGTTGGAATGCCTCAGCAACAAGAGAGGAAACCTGTACGACCTTTGTCCCCCTGGATTACTGATATATTGCTTGCTGCACCATTGGGCATCAGAAGTGACTATTTCCGCTGGTAA
BLAST of CSPI07G12480 vs. Swiss-Prot
Match: GIGAN_ARATH (Protein GIGANTEA OS=Arabidopsis thaliana GN=GI PE=1 SV=2) HSP 1 Score: 83.6 bits (205), Expect = 8.9e-16 Identity = 38/63 (60.32%), Postives = 45/63 (71.43%), Query Frame = 1
BLAST of CSPI07G12480 vs. Swiss-Prot
Match: GIGAN_ORYSJ (Protein GIGANTEA OS=Oryza sativa subsp. japonica GN=GI PE=2 SV=2) HSP 1 Score: 75.1 bits (183), Expect = 3.2e-13 Identity = 35/65 (53.85%), Postives = 50/65 (76.92%), Query Frame = 1
BLAST of CSPI07G12480 vs. TrEMBL
Match: A0A0A0K6B6_CUCSA (LATE BLOOMER 1 OS=Cucumis sativus GN=Csa_7G293230 PE=4 SV=1) HSP 1 Score: 128.6 bits (322), Expect = 2.7e-27 Identity = 62/64 (96.88%), Postives = 63/64 (98.44%), Query Frame = 1
BLAST of CSPI07G12480 vs. TrEMBL
Match: M5VIM2_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa000556mg PE=4 SV=1) HSP 1 Score: 98.2 bits (243), Expect = 3.9e-18 Identity = 50/65 (76.92%), Postives = 56/65 (86.15%), Query Frame = 1
BLAST of CSPI07G12480 vs. TrEMBL
Match: A0A0C4W438_PRUDU (Gigantea OS=Prunus dulcis PE=4 SV=1) HSP 1 Score: 97.8 bits (242), Expect = 5.1e-18 Identity = 50/65 (76.92%), Postives = 56/65 (86.15%), Query Frame = 1
BLAST of CSPI07G12480 vs. TrEMBL
Match: V4V6T3_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10004044mg PE=4 SV=1) HSP 1 Score: 97.1 bits (240), Expect = 8.7e-18 Identity = 50/64 (78.12%), Postives = 54/64 (84.38%), Query Frame = 1
BLAST of CSPI07G12480 vs. TrEMBL
Match: A0A067H897_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g001216mg PE=4 SV=1) HSP 1 Score: 97.1 bits (240), Expect = 8.7e-18 Identity = 50/64 (78.12%), Postives = 54/64 (84.38%), Query Frame = 1
BLAST of CSPI07G12480 vs. TAIR10
Match: AT1G22770.1 (AT1G22770.1 gigantea protein (GI)) HSP 1 Score: 83.6 bits (205), Expect = 5.0e-17 Identity = 38/63 (60.32%), Postives = 45/63 (71.43%), Query Frame = 1
BLAST of CSPI07G12480 vs. NCBI nr
Match: gi|778726488|ref|XP_011659108.1| (PREDICTED: protein GIGANTEA isoform X1 [Cucumis sativus]) HSP 1 Score: 128.6 bits (322), Expect = 3.9e-27 Identity = 62/64 (96.88%), Postives = 63/64 (98.44%), Query Frame = 1
BLAST of CSPI07G12480 vs. NCBI nr
Match: gi|700189221|gb|KGN44454.1| (LATE BLOOMER 1 [Cucumis sativus]) HSP 1 Score: 128.6 bits (322), Expect = 3.9e-27 Identity = 62/64 (96.88%), Postives = 63/64 (98.44%), Query Frame = 1
BLAST of CSPI07G12480 vs. NCBI nr
Match: gi|659123936|ref|XP_008461912.1| (PREDICTED: protein GIGANTEA-like isoform X1 [Cucumis melo]) HSP 1 Score: 125.9 bits (315), Expect = 2.5e-26 Identity = 61/64 (95.31%), Postives = 63/64 (98.44%), Query Frame = 1
BLAST of CSPI07G12480 vs. NCBI nr
Match: gi|470108349|ref|XP_004290483.1| (PREDICTED: protein GIGANTEA [Fragaria vesca subsp. vesca]) HSP 1 Score: 99.0 bits (245), Expect = 3.3e-18 Identity = 50/65 (76.92%), Postives = 56/65 (86.15%), Query Frame = 1
BLAST of CSPI07G12480 vs. NCBI nr
Match: gi|645263979|ref|XP_008237480.1| (PREDICTED: protein GIGANTEA [Prunus mume]) HSP 1 Score: 98.2 bits (243), Expect = 5.6e-18 Identity = 50/65 (76.92%), Postives = 56/65 (86.15%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|