CSPI04G22080 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGCTGTTTGGTTGTATGAAAATACTAGGAAATTTAGATCAGAAATCAAAGGTATTTTGATCAATACTTGTGCAGAGATAGAATCTCATGTGGTTAATATGATGTCAAGTGGCCCATCCTCACAAGTTCCTTCCTTGTATTGTGTTGGACCTATTTTGAACTTAGAAAACACTGTCAACCGAGTAAATATACTTAAATGGCTCGATGATCAGCCTCAAGCATCAGTGATCTTCTTGTGCTTTGGGAGTATGGGAAGCTTCGATGAGAGGAGCAAGTGA ATGGCTGTTTGGTTGTATGAAAATACTAGGAAATTTAGATCAGAAATCAAAGGTATTTTGATCAATACTTGTGCAGAGATAGAATCTCATGTGGTTAATATGATGTCAAGTGGCCCATCCTCACAAGTTCCTTCCTTGTATTGTGTTGGACCTATTTTGAACTTAGAAAACACTGTCAACCGAGTAAATATACTTAAATGGCTCGATGATCAGCCTCAAGCATCAGTGATCTTCTTGTGCTTTGGGAGTATGGGAAGCTTCGATGAGAGGAGCAAGTGA ATGGCTGTTTGGTTGTATGAAAATACTAGGAAATTTAGATCAGAAATCAAAGGTATTTTGATCAATACTTGTGCAGAGATAGAATCTCATGTGGTTAATATGATGTCAAGTGGCCCATCCTCACAAGTTCCTTCCTTGTATTGTGTTGGACCTATTTTGAACTTAGAAAACACTGTCAACCGAGTAAATATACTTAAATGGCTCGATGATCAGCCTCAAGCATCAGTGATCTTCTTGTGCTTTGGGAGTATGGGAAGCTTCGATGAGAGGAGCAAGTGA
BLAST of CSPI04G22080 vs. Swiss-Prot
Match: UFOG3_FRAAN (Putative UDP-glucose flavonoid 3-O-glucosyltransferase 3 OS=Fragaria ananassa GN=GT3 PE=2 SV=1) HSP 1 Score: 93.2 bits (230), Expect = 1.6e-18 Identity = 47/89 (52.81%), Postives = 64/89 (71.91%), Query Frame = 1
BLAST of CSPI04G22080 vs. Swiss-Prot
Match: U71B7_ARATH (UDP-glycosyltransferase 71B7 OS=Arabidopsis thaliana GN=UGT71B7 PE=2 SV=2) HSP 1 Score: 89.4 bits (220), Expect = 2.3e-17 Identity = 48/96 (50.00%), Postives = 64/96 (66.67%), Query Frame = 1
BLAST of CSPI04G22080 vs. Swiss-Prot
Match: UFOG6_MANES (Anthocyanidin 3-O-glucosyltransferase 6 (Fragment) OS=Manihot esculenta GN=GT6 PE=2 SV=1) HSP 1 Score: 87.4 bits (215), Expect = 8.8e-17 Identity = 42/79 (53.16%), Postives = 54/79 (68.35%), Query Frame = 1
BLAST of CSPI04G22080 vs. Swiss-Prot
Match: U71E1_STERE (UDP-glycosyltransferase 71E1 OS=Stevia rebaudiana GN=UGT71E1 PE=2 SV=1) HSP 1 Score: 85.9 bits (211), Expect = 2.6e-16 Identity = 39/79 (49.37%), Postives = 59/79 (74.68%), Query Frame = 1
BLAST of CSPI04G22080 vs. Swiss-Prot
Match: U71B2_ARATH (UDP-glycosyltransferase 71B2 OS=Arabidopsis thaliana GN=UGT71B2 PE=1 SV=1) HSP 1 Score: 85.9 bits (211), Expect = 2.6e-16 Identity = 45/91 (49.45%), Postives = 62/91 (68.13%), Query Frame = 1
BLAST of CSPI04G22080 vs. TrEMBL
Match: A0A0A0KZV7_CUCSA (Glycosyltransferase OS=Cucumis sativus GN=Csa_4G618530 PE=3 SV=1) HSP 1 Score: 187.2 bits (474), Expect = 9.1e-45 Identity = 89/89 (100.00%), Postives = 89/89 (100.00%), Query Frame = 1
BLAST of CSPI04G22080 vs. TrEMBL
Match: A0A0A0L321_CUCSA (Glycosyltransferase OS=Cucumis sativus GN=Csa_4G618520 PE=3 SV=1) HSP 1 Score: 119.0 bits (297), Expect = 3.0e-24 Identity = 57/97 (58.76%), Postives = 72/97 (74.23%), Query Frame = 1
BLAST of CSPI04G22080 vs. TrEMBL
Match: K7NBW4_SIRGR (Glycosyltransferase OS=Siraitia grosvenorii GN=UDPG7 PE=2 SV=1) HSP 1 Score: 113.6 bits (283), Expect = 1.3e-22 Identity = 53/96 (55.21%), Postives = 70/96 (72.92%), Query Frame = 1
BLAST of CSPI04G22080 vs. TrEMBL
Match: A0A0A0L341_CUCSA (Glycosyltransferase OS=Cucumis sativus GN=Csa_4G620550 PE=3 SV=1) HSP 1 Score: 102.8 bits (255), Expect = 2.3e-19 Identity = 45/89 (50.56%), Postives = 66/89 (74.16%), Query Frame = 1
BLAST of CSPI04G22080 vs. TrEMBL
Match: A0A0A0KZX3_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_4G620560 PE=4 SV=1) HSP 1 Score: 97.1 bits (240), Expect = 1.2e-17 Identity = 45/77 (58.44%), Postives = 61/77 (79.22%), Query Frame = 1
BLAST of CSPI04G22080 vs. TAIR10
Match: AT3G21790.1 (AT3G21790.1 UDP-Glycosyltransferase superfamily protein) HSP 1 Score: 89.4 bits (220), Expect = 1.3e-18 Identity = 48/96 (50.00%), Postives = 64/96 (66.67%), Query Frame = 1
BLAST of CSPI04G22080 vs. TAIR10
Match: AT3G21760.1 (AT3G21760.1 UDP-Glycosyltransferase superfamily protein) HSP 1 Score: 85.9 bits (211), Expect = 1.4e-17 Identity = 45/91 (49.45%), Postives = 62/91 (68.13%), Query Frame = 1
BLAST of CSPI04G22080 vs. TAIR10
Match: AT4G15260.1 (AT4G15260.1 UDP-Glycosyltransferase superfamily protein) HSP 1 Score: 84.0 bits (206), Expect = 5.5e-17 Identity = 42/84 (50.00%), Postives = 57/84 (67.86%), Query Frame = 1
BLAST of CSPI04G22080 vs. TAIR10
Match: AT3G21800.1 (AT3G21800.1 UDP-glucosyl transferase 71B8) HSP 1 Score: 81.6 bits (200), Expect = 2.7e-16 Identity = 43/86 (50.00%), Postives = 59/86 (68.60%), Query Frame = 1
BLAST of CSPI04G22080 vs. TAIR10
Match: AT4G15280.1 (AT4G15280.1 UDP-glucosyl transferase 71B5) HSP 1 Score: 80.9 bits (198), Expect = 4.6e-16 Identity = 41/84 (48.81%), Postives = 56/84 (66.67%), Query Frame = 1
BLAST of CSPI04G22080 vs. NCBI nr
Match: gi|700199830|gb|KGN54988.1| (hypothetical protein Csa_4G618530 [Cucumis sativus]) HSP 1 Score: 187.2 bits (474), Expect = 1.3e-44 Identity = 89/89 (100.00%), Postives = 89/89 (100.00%), Query Frame = 1
BLAST of CSPI04G22080 vs. NCBI nr
Match: gi|449456653|ref|XP_004146063.1| (PREDICTED: anthocyanidin 3-O-glucosyltransferase 2-like [Cucumis sativus]) HSP 1 Score: 119.0 bits (297), Expect = 4.4e-24 Identity = 57/97 (58.76%), Postives = 72/97 (74.23%), Query Frame = 1
BLAST of CSPI04G22080 vs. NCBI nr
Match: gi|659129348|ref|XP_008464641.1| (PREDICTED: anthocyanidin 3-O-glucosyltransferase 2-like [Cucumis melo]) HSP 1 Score: 116.7 bits (291), Expect = 2.2e-23 Identity = 56/97 (57.73%), Postives = 72/97 (74.23%), Query Frame = 1
BLAST of CSPI04G22080 vs. NCBI nr
Match: gi|778697790|ref|XP_011654405.1| (PREDICTED: putative UDP-glucose flavonoid 3-O-glucosyltransferase 3 [Cucumis sativus]) HSP 1 Score: 114.4 bits (285), Expect = 1.1e-22 Identity = 51/92 (55.43%), Postives = 73/92 (79.35%), Query Frame = 1
BLAST of CSPI04G22080 vs. NCBI nr
Match: gi|343466221|gb|AEM43004.1| (UDP-glucosyltransferase [Siraitia grosvenorii]) HSP 1 Score: 113.6 bits (283), Expect = 1.8e-22 Identity = 53/96 (55.21%), Postives = 70/96 (72.92%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|