CSPI03G29740 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGGAGATGAAGAAGATCGCCTGCGCCGTCCTCTTCGCTGCCGCAACCGTCACCGCCGTCGTAGCTGCAGATGAGGCCTTGGCTCCAGCACCTGGACCAAGCAGCGGCGCTGGCATTGGTGTCCCGGCAATTGGGTCTCTCGTCGGCGCTTCCTTGCTCTCCTTCGCCGCTTACTACTTGTAA ATGGAGATGAAGAAGATCGCCTGCGCCGTCCTCTTCGCTGCCGCAACCGTCACCGCCGTCGTAGCTGCAGATGAGGCCTTGGCTCCAGCACCTGGACCAAGCAGCGGCGCTGGCATTGGTGTCCCGGCAATTGGGTCTCTCGTCGGCGCTTCCTTGCTCTCCTTCGCCGCTTACTACTTGTAA ATGGAGATGAAGAAGATCGCCTGCGCCGTCCTCTTCGCTGCCGCAACCGTCACCGCCGTCGTAGCTGCAGATGAGGCCTTGGCTCCAGCACCTGGACCAAGCAGCGGCGCTGGCATTGGTGTCCCGGCAATTGGGTCTCTCGTCGGCGCTTCCTTGCTCTCCTTCGCCGCTTACTACTTGTAA
BLAST of CSPI03G29740 vs. Swiss-Prot
Match: AGP23_ARATH (Arabinogalactan peptide 23 OS=Arabidopsis thaliana GN=AGP23 PE=2 SV=2) HSP 1 Score: 75.1 bits (183), Expect = 3.0e-13 Identity = 42/60 (70.00%), Postives = 51/60 (85.00%), Query Frame = 1
BLAST of CSPI03G29740 vs. TrEMBL
Match: A0A0A0L9U8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G697910 PE=4 SV=1) HSP 1 Score: 105.5 bits (262), Expect = 2.3e-20 Identity = 60/60 (100.00%), Postives = 60/60 (100.00%), Query Frame = 1
BLAST of CSPI03G29740 vs. TrEMBL
Match: A0A087GYR2_ARAAL (Uncharacterized protein OS=Arabis alpina GN=AALP_AA5G222900 PE=4 SV=1) HSP 1 Score: 76.6 bits (187), Expect = 1.1e-11 Identity = 42/60 (70.00%), Postives = 52/60 (86.67%), Query Frame = 1
BLAST of CSPI03G29740 vs. TrEMBL
Match: A0A0D3CUE4_BRAOL (Uncharacterized protein OS=Brassica oleracea var. oleracea PE=4 SV=1) HSP 1 Score: 76.3 bits (186), Expect = 1.5e-11 Identity = 42/60 (70.00%), Postives = 52/60 (86.67%), Query Frame = 1
BLAST of CSPI03G29740 vs. TrEMBL
Match: A0A078I6S4_BRANA (BnaA04g02260D protein OS=Brassica napus GN=BnaCnng14120D PE=4 SV=1) HSP 1 Score: 75.5 bits (184), Expect = 2.5e-11 Identity = 41/60 (68.33%), Postives = 52/60 (86.67%), Query Frame = 1
BLAST of CSPI03G29740 vs. TrEMBL
Match: A0A078JAR3_BRANA (BnaCnng40600D protein OS=Brassica napus GN=BnaCnng40600D PE=4 SV=1) HSP 1 Score: 75.5 bits (184), Expect = 2.5e-11 Identity = 42/60 (70.00%), Postives = 51/60 (85.00%), Query Frame = 1
BLAST of CSPI03G29740 vs. TAIR10
Match: AT3G57690.1 (AT3G57690.1 arabinogalactan protein 23) HSP 1 Score: 75.1 bits (183), Expect = 1.7e-14 Identity = 42/60 (70.00%), Postives = 51/60 (85.00%), Query Frame = 1
BLAST of CSPI03G29740 vs. TAIR10
Match: AT2G41905.1 (AT2G41905.1 BEST Arabidopsis thaliana protein match is: arabinogalactan protein 23 (TAIR:AT3G57690.1)) HSP 1 Score: 69.7 bits (169), Expect = 7.0e-13 Identity = 44/61 (72.13%), Postives = 52/61 (85.25%), Query Frame = 1
BLAST of CSPI03G29740 vs. NCBI nr
Match: gi|700203465|gb|KGN58598.1| (hypothetical protein Csa_3G697910 [Cucumis sativus]) HSP 1 Score: 105.5 bits (262), Expect = 3.3e-20 Identity = 60/60 (100.00%), Postives = 60/60 (100.00%), Query Frame = 1
BLAST of CSPI03G29740 vs. NCBI nr
Match: gi|674242249|gb|KFK35014.1| (hypothetical protein AALP_AA5G222900 [Arabis alpina]) HSP 1 Score: 76.6 bits (187), Expect = 1.6e-11 Identity = 42/60 (70.00%), Postives = 52/60 (86.67%), Query Frame = 1
BLAST of CSPI03G29740 vs. NCBI nr
Match: gi|923737603|ref|XP_013670224.1| (PREDICTED: arabinogalactan peptide 23-like [Brassica napus]) HSP 1 Score: 75.5 bits (184), Expect = 3.6e-11 Identity = 42/60 (70.00%), Postives = 51/60 (85.00%), Query Frame = 1
BLAST of CSPI03G29740 vs. NCBI nr
Match: gi|685296339|ref|XP_009139022.1| (PREDICTED: arabinogalactan peptide 23 [Brassica rapa]) HSP 1 Score: 75.5 bits (184), Expect = 3.6e-11 Identity = 41/60 (68.33%), Postives = 52/60 (86.67%), Query Frame = 1
BLAST of CSPI03G29740 vs. NCBI nr
Match: gi|15230372|ref|NP_191328.1| (arabinogalactan protein 23 [Arabidopsis thaliana]) HSP 1 Score: 75.1 bits (183), Expect = 4.7e-11 Identity = 42/60 (70.00%), Postives = 51/60 (85.00%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene: |