CSPI03G21650 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGATCCGGAAGCTTCCGTTTCAACGTTTAGTTCGTGAAATTGCTCAGAATTTCAAAACCGACCTGAGGTTCCAGAGCAGTGTCGTCGCGACGCTTCAGGAAGCGGTCGAAGCCTATTTGGTTGGTTTGTTTGAGGATACAAATCTTTGTGCTATTTATGCTAAGAGGATAACCATTATGCCTGAGGATATTCAATTGGCAAGGAGGATTAGAGGGGAAAGGGCTTAG ATGATCCGGAAGCTTCCGTTTCAACGTTTAGTTCGTGAAATTGCTCAGAATTTCAAAACCGACCTGAGGTTCCAGAGCAGTGTCGTCGCGACGCTTCAGGAAGCGGTCGAAGCCTATTTGGTTGGTTTGTTTGAGGATACAAATCTTTGTGCTATTTATGCTAAGAGGATAACCATTATGCCTGAGGATATTCAATTGGCAAGGAGGATTAGAGGGGAAAGGGCTTAG ATGATCCGGAAGCTTCCGTTTCAACGTTTAGTTCGTGAAATTGCTCAGAATTTCAAAACCGACCTGAGGTTCCAGAGCAGTGTCGTCGCGACGCTTCAGGAAGCGGTCGAAGCCTATTTGGTTGGTTTGTTTGAGGATACAAATCTTTGTGCTATTTATGCTAAGAGGATAACCATTATGCCTGAGGATATTCAATTGGCAAGGAGGATTAGAGGGGAAAGGGCTTAG
BLAST of CSPI03G21650 vs. Swiss-Prot
Match: H32_EUPES (Histone H3.2 OS=Euphorbia esula GN=H3 PE=2 SV=3) HSP 1 Score: 134.0 bits (336), Expect = 6.7e-31 Identity = 67/75 (89.33%), Postives = 72/75 (96.00%), Query Frame = 1
BLAST of CSPI03G21650 vs. Swiss-Prot
Match: H32_ENCAL (Histone H3.2 OS=Encephalartos altensteinii PE=1 SV=2) HSP 1 Score: 134.0 bits (336), Expect = 6.7e-31 Identity = 67/75 (89.33%), Postives = 72/75 (96.00%), Query Frame = 1
BLAST of CSPI03G21650 vs. Swiss-Prot
Match: H32_ASPOF (Histone H3.2 OS=Asparagus officinalis PE=2 SV=3) HSP 1 Score: 134.0 bits (336), Expect = 6.7e-31 Identity = 67/75 (89.33%), Postives = 72/75 (96.00%), Query Frame = 1
BLAST of CSPI03G21650 vs. Swiss-Prot
Match: H32_ARATH (Histone H3.2 OS=Arabidopsis thaliana GN=HTR2 PE=1 SV=2) HSP 1 Score: 134.0 bits (336), Expect = 6.7e-31 Identity = 67/75 (89.33%), Postives = 72/75 (96.00%), Query Frame = 1
BLAST of CSPI03G21650 vs. Swiss-Prot
Match: H32_ORYSI (Histone H3.2 OS=Oryza sativa subsp. indica GN=OsI_019426 PE=2 SV=1) HSP 1 Score: 134.0 bits (336), Expect = 6.7e-31 Identity = 67/75 (89.33%), Postives = 72/75 (96.00%), Query Frame = 1
BLAST of CSPI03G21650 vs. TrEMBL
Match: A0A0A0LUA6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G392600 PE=3 SV=1) HSP 1 Score: 146.0 bits (367), Expect = 1.9e-32 Identity = 75/75 (100.00%), Postives = 75/75 (100.00%), Query Frame = 1
BLAST of CSPI03G21650 vs. TrEMBL
Match: V4VS74_9ROSI (Histone H3 OS=Citrus clementina GN=CICLE_v10024580mg PE=3 SV=1) HSP 1 Score: 134.4 bits (337), Expect = 5.7e-29 Identity = 67/75 (89.33%), Postives = 72/75 (96.00%), Query Frame = 1
BLAST of CSPI03G21650 vs. TrEMBL
Match: S8E2N0_9LAMI (Histone H3 OS=Genlisea aurea GN=M569_04854 PE=3 SV=1) HSP 1 Score: 134.0 bits (336), Expect = 7.5e-29 Identity = 67/75 (89.33%), Postives = 72/75 (96.00%), Query Frame = 1
BLAST of CSPI03G21650 vs. TrEMBL
Match: V4KSU7_EUTSA (Histone H3 OS=Eutrema salsugineum GN=EUTSA_v10005111mg PE=3 SV=1) HSP 1 Score: 134.0 bits (336), Expect = 7.5e-29 Identity = 67/75 (89.33%), Postives = 72/75 (96.00%), Query Frame = 1
BLAST of CSPI03G21650 vs. TrEMBL
Match: A0A096TZU4_MAIZE (Histone H3.2 OS=Zea mays GN=H3C4 PE=3 SV=1) HSP 1 Score: 134.0 bits (336), Expect = 7.5e-29 Identity = 67/75 (89.33%), Postives = 72/75 (96.00%), Query Frame = 1
BLAST of CSPI03G21650 vs. TAIR10
Match: AT1G09200.1 (AT1G09200.1 Histone superfamily protein) HSP 1 Score: 134.0 bits (336), Expect = 3.8e-32 Identity = 67/75 (89.33%), Postives = 72/75 (96.00%), Query Frame = 1
BLAST of CSPI03G21650 vs. TAIR10
Match: AT3G27360.1 (AT3G27360.1 Histone superfamily protein) HSP 1 Score: 134.0 bits (336), Expect = 3.8e-32 Identity = 67/75 (89.33%), Postives = 72/75 (96.00%), Query Frame = 1
BLAST of CSPI03G21650 vs. TAIR10
Match: AT5G10390.1 (AT5G10390.1 Histone superfamily protein) HSP 1 Score: 134.0 bits (336), Expect = 3.8e-32 Identity = 67/75 (89.33%), Postives = 72/75 (96.00%), Query Frame = 1
BLAST of CSPI03G21650 vs. TAIR10
Match: AT5G10400.1 (AT5G10400.1 Histone superfamily protein) HSP 1 Score: 134.0 bits (336), Expect = 3.8e-32 Identity = 67/75 (89.33%), Postives = 72/75 (96.00%), Query Frame = 1
BLAST of CSPI03G21650 vs. TAIR10
Match: AT5G65360.1 (AT5G65360.1 Histone superfamily protein) HSP 1 Score: 134.0 bits (336), Expect = 3.8e-32 Identity = 67/75 (89.33%), Postives = 72/75 (96.00%), Query Frame = 1
BLAST of CSPI03G21650 vs. NCBI nr
Match: gi|700210282|gb|KGN65378.1| (hypothetical protein Csa_1G392600 [Cucumis sativus]) HSP 1 Score: 146.0 bits (367), Expect = 2.7e-32 Identity = 75/75 (100.00%), Postives = 75/75 (100.00%), Query Frame = 1
BLAST of CSPI03G21650 vs. NCBI nr
Match: gi|166384|gb|AAA32655.1| (histone H3 (H3-1.1) [Medicago sativa]) HSP 1 Score: 134.4 bits (337), Expect = 8.2e-29 Identity = 67/75 (89.33%), Postives = 73/75 (97.33%), Query Frame = 1
BLAST of CSPI03G21650 vs. NCBI nr
Match: gi|567900422|ref|XP_006442699.1| (hypothetical protein CICLE_v10024580mg [Citrus clementina]) HSP 1 Score: 134.4 bits (337), Expect = 8.2e-29 Identity = 67/75 (89.33%), Postives = 72/75 (96.00%), Query Frame = 1
BLAST of CSPI03G21650 vs. NCBI nr
Match: gi|643697049|gb|KDP20192.1| (hypothetical protein JCGZ_07912 [Jatropha curcas]) HSP 1 Score: 134.0 bits (336), Expect = 1.1e-28 Identity = 67/75 (89.33%), Postives = 72/75 (96.00%), Query Frame = 1
BLAST of CSPI03G21650 vs. NCBI nr
Match: gi|224865|prf||1202289A (histone H3) HSP 1 Score: 134.0 bits (336), Expect = 1.1e-28 Identity = 67/75 (89.33%), Postives = 72/75 (96.00%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|