CSPI03G18680 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDSthree_prime_UTR Hold the cursor over a type above to highlight its positions in the sequence below.ATGTCCATGTTTCTTGCTGGTTTAGAGGATGAGACATCAGTGAGGGTTAAGCCTTTGGAGAAGGACATGTGTGGGAGAAGTAGACTTGCGTTCTTTATAGGGGTTGCTACTGTTGTTACTAAGTTGTTCAATACTGTGGAACTCGATGTTGCAGTGTTTGGAAAGAAGGATTATCAGGCGGATGGTGAGTCTTTGTAAGAATGTGAATGATTTTGATTTTCATACTTGTTTTGTGCTCAAAATTCATTGTTATTCATTTGAAT ATGTCCATGTTTCTTGCTGGTTTAGAGGATGAGACATCAGTGAGGGTTAAGCCTTTGGAGAAGGACATGTGTGGGAGAAGTAGACTTGCGTTCTTTATAGGGGTTGCTACTGTTGTTACTAAGTTGTTCAATACTGTGGAACTCGATGTTGCAGTGTTTGGAAAGAAGGATTATCAGGCGGATGGTGAGTCTTTGTAA ATGTCCATGTTTCTTGCTGGTTTAGAGGATGAGACATCAGTGAGGGTTAAGCCTTTGGAGAAGGACATGTGTGGGAGAAGTAGACTTGCGTTCTTTATAGGGGTTGCTACTGTTGTTACTAAGTTGTTCAATACTGTGGAACTCGATGTTGCAGTGTTTGGAAAGAAGGATTATCAGGCGGATGGTGAGTCTTTGTAA
BLAST of CSPI03G18680 vs. Swiss-Prot
Match: PANC_ARATH (Pantoate--beta-alanine ligase OS=Arabidopsis thaliana GN=At5g48840 PE=1 SV=1) HSP 1 Score: 76.3 bits (186), Expect = 1.4e-13 Identity = 37/53 (69.81%), Postives = 42/53 (79.25%), Query Frame = 1
BLAST of CSPI03G18680 vs. Swiss-Prot
Match: PANC_LOTJA (Pantoate--beta-alanine ligase OS=Lotus japonicus GN=PANC PE=1 SV=3) HSP 1 Score: 76.3 bits (186), Expect = 1.4e-13 Identity = 37/54 (68.52%), Postives = 42/54 (77.78%), Query Frame = 1
BLAST of CSPI03G18680 vs. Swiss-Prot
Match: PANC_ORYSJ (Pantoate--beta-alanine ligase OS=Oryza sativa subsp. japonica GN=PANC PE=2 SV=2) HSP 1 Score: 75.1 bits (183), Expect = 3.2e-13 Identity = 38/54 (70.37%), Postives = 42/54 (77.78%), Query Frame = 1
BLAST of CSPI03G18680 vs. Swiss-Prot
Match: PANC_PSEMY (Pantothenate synthetase OS=Pseudomonas mendocina (strain ymp) GN=panC PE=3 SV=1) HSP 1 Score: 66.2 bits (160), Expect = 1.5e-10 Identity = 32/57 (56.14%), Postives = 41/57 (71.93%), Query Frame = 1
BLAST of CSPI03G18680 vs. Swiss-Prot
Match: PANC_ALKEH (Pantothenate synthetase OS=Alkalilimnicola ehrlichii (strain ATCC BAA-1101 / DSM 17681 / MLHE-1) GN=panC PE=3 SV=1) HSP 1 Score: 64.7 bits (156), Expect = 4.3e-10 Identity = 32/57 (56.14%), Postives = 38/57 (66.67%), Query Frame = 1
BLAST of CSPI03G18680 vs. TrEMBL
Match: A0A0A0K7A9_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_7G061730 PE=4 SV=1) HSP 1 Score: 96.3 bits (238), Expect = 1.5e-17 Identity = 52/66 (78.79%), Postives = 53/66 (80.30%), Query Frame = 1
BLAST of CSPI03G18680 vs. TrEMBL
Match: D7MMN0_ARALL (Pantoate-beta-alanine ligase OS=Arabidopsis lyrata subsp. lyrata GN=ARALYDRAFT_494947 PE=3 SV=1) HSP 1 Score: 78.2 bits (191), Expect = 4.2e-12 Identity = 38/53 (71.70%), Postives = 43/53 (81.13%), Query Frame = 1
BLAST of CSPI03G18680 vs. TrEMBL
Match: M5VKJ0_PRUPE (Uncharacterized protein OS=Prunus persica GN=PRUPE_ppa008786mg PE=3 SV=1) HSP 1 Score: 78.2 bits (191), Expect = 4.2e-12 Identity = 40/53 (75.47%), Postives = 43/53 (81.13%), Query Frame = 1
BLAST of CSPI03G18680 vs. TrEMBL
Match: A0A164Z4E3_DAUCA (Uncharacterized protein OS=Daucus carota subsp. sativus GN=DCAR_018553 PE=4 SV=1) HSP 1 Score: 78.2 bits (191), Expect = 4.2e-12 Identity = 39/53 (73.58%), Postives = 43/53 (81.13%), Query Frame = 1
BLAST of CSPI03G18680 vs. TrEMBL
Match: A0A0A0L9F0_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_3G223300 PE=4 SV=1) HSP 1 Score: 78.2 bits (191), Expect = 4.2e-12 Identity = 39/50 (78.00%), Postives = 41/50 (82.00%), Query Frame = 1
BLAST of CSPI03G18680 vs. TAIR10
Match: AT5G48840.1 (AT5G48840.1 homolog of bacterial PANC) HSP 1 Score: 76.3 bits (186), Expect = 8.1e-15 Identity = 37/53 (69.81%), Postives = 42/53 (79.25%), Query Frame = 1
BLAST of CSPI03G18680 vs. NCBI nr
Match: gi|700188473|gb|KGN43706.1| (hypothetical protein Csa_7G061730 [Cucumis sativus]) HSP 1 Score: 96.3 bits (238), Expect = 2.2e-17 Identity = 52/66 (78.79%), Postives = 53/66 (80.30%), Query Frame = 1
BLAST of CSPI03G18680 vs. NCBI nr
Match: gi|694415730|ref|XP_009336027.1| (PREDICTED: pantoate--beta-alanine ligase-like isoform X1 [Pyrus x bretschneideri]) HSP 1 Score: 79.0 bits (193), Expect = 3.6e-12 Identity = 40/53 (75.47%), Postives = 43/53 (81.13%), Query Frame = 1
BLAST of CSPI03G18680 vs. NCBI nr
Match: gi|657961727|ref|XP_008372459.1| (PREDICTED: LOW QUALITY PROTEIN: pantoate--beta-alanine ligase [Malus domestica]) HSP 1 Score: 78.6 bits (192), Expect = 4.6e-12 Identity = 39/53 (73.58%), Postives = 43/53 (81.13%), Query Frame = 1
BLAST of CSPI03G18680 vs. NCBI nr
Match: gi|595793359|ref|XP_007200428.1| (hypothetical protein PRUPE_ppa008786mg [Prunus persica]) HSP 1 Score: 78.2 bits (191), Expect = 6.1e-12 Identity = 40/53 (75.47%), Postives = 43/53 (81.13%), Query Frame = 1
BLAST of CSPI03G18680 vs. NCBI nr
Match: gi|727422114|ref|XP_010439740.1| (PREDICTED: pantoate--beta-alanine ligase-like isoform X1 [Camelina sativa]) HSP 1 Score: 78.2 bits (191), Expect = 6.1e-12 Identity = 38/53 (71.70%), Postives = 43/53 (81.13%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|