CSPI02G05920 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: five_prime_UTRCDSthree_prime_UTR Hold the cursor over a type above to highlight its positions in the sequence below.TGCAACCACCAGAGAGAATCTCTTATCACCACATGGAGGCAGAGGCAGCCGCCCCCATCACACCATGGCATTCGCCCTTACCGTACTTATTCGGTGCCCTTGCTGCCGTTTGTATTCTTATCTCTTTTTCTCTATTGATCCTTGGCTGTTCCTATTGCCGGAAGGTTTCTGTTTCTATATTGAACGGCAACCACGGTGCTGCTCGAGATGCTGACATGGAGTCTGGTCGAGGCAAAAGCGACGGTGATCTGAATCCGCTACCATGCGCCATGTTTAACGACAAGGTCTTGGTTATAATGGCTGGACAAGTTAACCCAAGCTTTATAGCTACTCCCATGTCGACGGGGTTGTCCTGAAAAGGCGGAGGCAACGACGGTGGCGGAGCATGGTGTGATGAGTGATAATTTTTTTTTGGTTACTTTCCTTATTTTAATTTGAAAATTGATCTTCTTAATATATGTAAATGTCATTGTTTTTGGGTGTTAATTTTTCTTTTCCATTTAGTCCTTACAATCACCAATTATATGTTAAAATATTTATATGAAAACCTATAGTATTATGAAATTGATGGTTGTTACAATA ATGGAGGCAGAGGCAGCCGCCCCCATCACACCATGGCATTCGCCCTTACCGTACTTATTCGGTGCCCTTGCTGCCGTTTGTATTCTTATCTCTTTTTCTCTATTGATCCTTGGCTGTTCCTATTGCCGGAAGGTTTCTGTTTCTATATTGAACGGCAACCACGGTGCTGCTCGAGATGCTGACATGGAGTCTGGTCGAGGCAAAAGCGACGGTGATCTGAATCCGCTACCATGCGCCATGTTTAACGACAAGGTCTTGGTTATAATGGCTGGACAAGTTAACCCAAGCTTTATAGCTACTCCCATGTCGACGGGGTTGTCCTGA ATGGAGGCAGAGGCAGCCGCCCCCATCACACCATGGCATTCGCCCTTACCGTACTTATTCGGTGCCCTTGCTGCCGTTTGTATTCTTATCTCTTTTTCTCTATTGATCCTTGGCTGTTCCTATTGCCGGAAGGTTTCTGTTTCTATATTGAACGGCAACCACGGTGCTGCTCGAGATGCTGACATGGAGTCTGGTCGAGGCAAAAGCGACGGTGATCTGAATCCGCTACCATGCGCCATGTTTAACGACAAGGTCTTGGTTATAATGGCTGGACAAGTTAACCCAAGCTTTATAGCTACTCCCATGTCGACGGGGTTGTCCTGA
BLAST of CSPI02G05920 vs. Swiss-Prot
Match: GDU3_ARATH (Protein GLUTAMINE DUMPER 3 OS=Arabidopsis thaliana GN=GDU3 PE=2 SV=1) HSP 1 Score: 79.0 bits (193), Expect = 3.6e-14 Identity = 45/94 (47.87%), Postives = 59/94 (62.77%), Query Frame = 1
BLAST of CSPI02G05920 vs. Swiss-Prot
Match: GDU2_ARATH (Protein GLUTAMINE DUMPER 2 OS=Arabidopsis thaliana GN=GDU2 PE=2 SV=1) HSP 1 Score: 75.5 bits (184), Expect = 4.0e-13 Identity = 45/95 (47.37%), Postives = 58/95 (61.05%), Query Frame = 1
BLAST of CSPI02G05920 vs. Swiss-Prot
Match: GDU4_ARATH (Protein GLUTAMINE DUMPER 4 OS=Arabidopsis thaliana GN=GDU4 PE=2 SV=1) HSP 1 Score: 74.3 bits (181), Expect = 9.0e-13 Identity = 46/94 (48.94%), Postives = 56/94 (59.57%), Query Frame = 1
BLAST of CSPI02G05920 vs. Swiss-Prot
Match: GDU5_ARATH (Protein GLUTAMINE DUMPER 5 OS=Arabidopsis thaliana GN=GDU5 PE=2 SV=2) HSP 1 Score: 68.9 bits (167), Expect = 3.8e-11 Identity = 39/94 (41.49%), Postives = 57/94 (60.64%), Query Frame = 1
BLAST of CSPI02G05920 vs. Swiss-Prot
Match: GDU1_ARATH (Protein GLUTAMINE DUMPER 1 OS=Arabidopsis thaliana GN=GDU1 PE=1 SV=1) HSP 1 Score: 68.9 bits (167), Expect = 3.8e-11 Identity = 42/94 (44.68%), Postives = 55/94 (58.51%), Query Frame = 1
BLAST of CSPI02G05920 vs. TrEMBL
Match: A0A0A0LMC7_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G058100 PE=4 SV=1) HSP 1 Score: 215.7 bits (548), Expect = 2.8e-53 Identity = 107/107 (100.00%), Postives = 107/107 (100.00%), Query Frame = 1
BLAST of CSPI02G05920 vs. TrEMBL
Match: V4UVI5_9ROSI (Uncharacterized protein OS=Citrus clementina GN=CICLE_v10009784mg PE=4 SV=1) HSP 1 Score: 97.1 bits (240), Expect = 1.4e-17 Identity = 51/95 (53.68%), Postives = 71/95 (74.74%), Query Frame = 1
BLAST of CSPI02G05920 vs. TrEMBL
Match: A0A067FG36_CITSI (Uncharacterized protein OS=Citrus sinensis GN=CISIN_1g031677mg PE=4 SV=1) HSP 1 Score: 97.1 bits (240), Expect = 1.4e-17 Identity = 51/95 (53.68%), Postives = 71/95 (74.74%), Query Frame = 1
BLAST of CSPI02G05920 vs. TrEMBL
Match: U5GBM9_POPTR (Uncharacterized protein OS=Populus trichocarpa GN=POPTR_0006s18790g PE=4 SV=1) HSP 1 Score: 96.7 bits (239), Expect = 1.9e-17 Identity = 53/100 (53.00%), Postives = 68/100 (68.00%), Query Frame = 1
BLAST of CSPI02G05920 vs. TrEMBL
Match: W9RVB1_9ROSA (Uncharacterized protein OS=Morus notabilis GN=L484_022857 PE=4 SV=1) HSP 1 Score: 93.2 bits (230), Expect = 2.1e-16 Identity = 55/102 (53.92%), Postives = 72/102 (70.59%), Query Frame = 1
BLAST of CSPI02G05920 vs. TAIR10
Match: AT5G57685.1 (AT5G57685.1 glutamine dumper 3) HSP 1 Score: 79.0 bits (193), Expect = 2.1e-15 Identity = 45/94 (47.87%), Postives = 59/94 (62.77%), Query Frame = 1
BLAST of CSPI02G05920 vs. TAIR10
Match: AT4G25760.1 (AT4G25760.1 glutamine dumper 2) HSP 1 Score: 75.5 bits (184), Expect = 2.3e-14 Identity = 45/95 (47.37%), Postives = 58/95 (61.05%), Query Frame = 1
BLAST of CSPI02G05920 vs. TAIR10
Match: AT2G24762.1 (AT2G24762.1 glutamine dumper 4) HSP 1 Score: 74.3 bits (181), Expect = 5.1e-14 Identity = 46/94 (48.94%), Postives = 56/94 (59.57%), Query Frame = 1
BLAST of CSPI02G05920 vs. TAIR10
Match: AT5G24920.1 (AT5G24920.1 glutamine dumper 5) HSP 1 Score: 68.9 bits (167), Expect = 2.1e-12 Identity = 39/94 (41.49%), Postives = 57/94 (60.64%), Query Frame = 1
BLAST of CSPI02G05920 vs. TAIR10
Match: AT4G31730.1 (AT4G31730.1 glutamine dumper 1) HSP 1 Score: 68.9 bits (167), Expect = 2.1e-12 Identity = 42/94 (44.68%), Postives = 55/94 (58.51%), Query Frame = 1
BLAST of CSPI02G05920 vs. NCBI nr
Match: gi|778674059|ref|XP_011650119.1| (PREDICTED: protein GLUTAMINE DUMPER 3-like [Cucumis sativus]) HSP 1 Score: 215.7 bits (548), Expect = 4.0e-53 Identity = 107/107 (100.00%), Postives = 107/107 (100.00%), Query Frame = 1
BLAST of CSPI02G05920 vs. NCBI nr
Match: gi|659071530|ref|XP_008460400.1| (PREDICTED: protein GLUTAMINE DUMPER 1-like [Cucumis melo]) HSP 1 Score: 196.8 bits (499), Expect = 1.9e-47 Identity = 95/105 (90.48%), Postives = 100/105 (95.24%), Query Frame = 1
BLAST of CSPI02G05920 vs. NCBI nr
Match: gi|567922880|ref|XP_006453446.1| (hypothetical protein CICLE_v10009784mg [Citrus clementina]) HSP 1 Score: 97.1 bits (240), Expect = 2.1e-17 Identity = 51/95 (53.68%), Postives = 71/95 (74.74%), Query Frame = 1
BLAST of CSPI02G05920 vs. NCBI nr
Match: gi|566176979|ref|XP_006381847.1| (hypothetical protein POPTR_0006s18790g [Populus trichocarpa]) HSP 1 Score: 96.7 bits (239), Expect = 2.7e-17 Identity = 53/100 (53.00%), Postives = 68/100 (68.00%), Query Frame = 1
BLAST of CSPI02G05920 vs. NCBI nr
Match: gi|702289493|ref|XP_010047015.1| (PREDICTED: protein GLUTAMINE DUMPER 2 [Eucalyptus grandis]) HSP 1 Score: 94.0 bits (232), Expect = 1.7e-16 Identity = 56/105 (53.33%), Postives = 70/105 (66.67%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene: The following gene(s) are paralogous to this gene:
The following block(s) are covering this gene:
|