CSPI01G04570 (gene) Wild cucumber (PI 183967)
The following sequences are available for this feature:
Legend: CDS Hold the cursor over a type above to highlight its positions in the sequence below.ATGTGGAAGCTCAAAGTTTCCGAAGGATGGGAGACAAGTGAGAACGATCACGTAGGAAGACAATATTGGAAATTCGACACAAATCTCACACCTTCTGAAGAAGAAAAAGCTCAAATACAAAAGTTTTGTAATGAGTTTTACCGTAATCGTTTTCGAGCTAAGCACAGCTCTGATCTTTTAATGAGATTTCAGGTTAGTTTAATCTATATAAACTTATATTTATGTTTCTCGTATTTTTTTGTAAATACGTCTCTAAATGCATCTAAGTATTAGAAAATGTTCTTTCTTATATTCATTAGTTTAGTTTGATTTTTTTTTTTCGTGAAAGATAGCTTCAAAGAAGAAGATGAACAATTAA ATGTGGAAGCTCAAAGTTTCCGAAGGATGGGAGACAAGTGAGAACGATCACGTAGGAAGACAATATTGGAAATTCGACACAAATCTCACACCTTCTGAAGAAGAAAAAGCTCAAATACAAAAGTTTTGTAATGAGTTTTACCGTAATCGTTTTCGAGCTAAGCACAGCTCTGATCTTTTAATGAGATTTCAGATAGCTTCAAAGAAGAAGATGAACAATTAA ATGTGGAAGCTCAAAGTTTCCGAAGGATGGGAGACAAGTGAGAACGATCACGTAGGAAGACAATATTGGAAATTCGACACAAATCTCACACCTTCTGAAGAAGAAAAAGCTCAAATACAAAAGTTTTGTAATGAGTTTTACCGTAATCGTTTTCGAGCTAAGCACAGCTCTGATCTTTTAATGAGATTTCAGATAGCTTCAAAGAAGAAGATGAACAATTAA
BLAST of CSPI01G04570 vs. Swiss-Prot
Match: OXSC_CUCPE (Probable oxidosqualene cyclase OS=Cucurbita pepo GN=CPR PE=2 SV=1) HSP 1 Score: 99.4 bits (246), Expect = 1.8e-20 Identity = 45/72 (62.50%), Postives = 57/72 (79.17%), Query Frame = 1
BLAST of CSPI01G04570 vs. Swiss-Prot
Match: CAS1_PANGI (Cycloartenol Synthase OS=Panax ginseng GN=OSCPNX1 PE=1 SV=1) HSP 1 Score: 73.9 bits (180), Expect = 8.0e-13 Identity = 37/71 (52.11%), Postives = 49/71 (69.01%), Query Frame = 1
BLAST of CSPI01G04570 vs. Swiss-Prot
Match: CAS1_RICCO (Cycloartenol synthase OS=Ricinus communis PE=1 SV=1) HSP 1 Score: 73.6 bits (179), Expect = 1.0e-12 Identity = 35/72 (48.61%), Postives = 48/72 (66.67%), Query Frame = 1
BLAST of CSPI01G04570 vs. Swiss-Prot
Match: CAS1_GLYGL (Cycloartenol synthase OS=Glycyrrhiza glabra GN=GgCAS1 PE=1 SV=1) HSP 1 Score: 70.9 bits (172), Expect = 6.8e-12 Identity = 37/75 (49.33%), Postives = 48/75 (64.00%), Query Frame = 1
BLAST of CSPI01G04570 vs. Swiss-Prot
Match: LAS1_ARATH (Lanosterol synthase OS=Arabidopsis thaliana GN=LAS1 PE=2 SV=1) HSP 1 Score: 70.5 bits (171), Expect = 8.9e-12 Identity = 36/69 (52.17%), Postives = 46/69 (66.67%), Query Frame = 1
BLAST of CSPI01G04570 vs. TrEMBL
Match: A0A0A0LQ14_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_1G025800 PE=4 SV=1) HSP 1 Score: 141.4 bits (355), Expect = 4.6e-31 Identity = 67/73 (91.78%), Postives = 69/73 (94.52%), Query Frame = 1
BLAST of CSPI01G04570 vs. TrEMBL
Match: Q9SSU5_LUFAE (Terpene cyclase/mutase family member OS=Luffa aegyptiaca GN=LcOSC2 PE=2 SV=1) HSP 1 Score: 114.0 bits (284), Expect = 7.8e-23 Identity = 50/72 (69.44%), Postives = 59/72 (81.94%), Query Frame = 1
BLAST of CSPI01G04570 vs. TrEMBL
Match: M5XWK0_PRUPE (Terpene cyclase/mutase family member OS=Prunus persica GN=PRUPE_ppa022710mg PE=3 SV=1) HSP 1 Score: 89.0 bits (219), Expect = 2.7e-15 Identity = 45/73 (61.64%), Postives = 58/73 (79.45%), Query Frame = 1
BLAST of CSPI01G04570 vs. TrEMBL
Match: A0A059CRH1_EUCGR (Terpene cyclase/mutase family member OS=Eucalyptus grandis GN=EUGRSUZ_C02167 PE=3 SV=1) HSP 1 Score: 86.7 bits (213), Expect = 1.3e-14 Identity = 42/69 (60.87%), Postives = 50/69 (72.46%), Query Frame = 1
BLAST of CSPI01G04570 vs. TrEMBL
Match: U5GC23_POPTR (Terpene cyclase/mutase family member OS=Populus trichocarpa GN=POPTR_0006s07870g PE=3 SV=1) HSP 1 Score: 84.0 bits (206), Expect = 8.6e-14 Identity = 43/70 (61.43%), Postives = 54/70 (77.14%), Query Frame = 1
BLAST of CSPI01G04570 vs. TAIR10
Match: AT3G45130.1 (AT3G45130.1 lanosterol synthase 1) HSP 1 Score: 70.5 bits (171), Expect = 5.0e-13 Identity = 36/69 (52.17%), Postives = 46/69 (66.67%), Query Frame = 1
BLAST of CSPI01G04570 vs. TAIR10
Match: AT2G07050.1 (AT2G07050.1 cycloartenol synthase 1) HSP 1 Score: 68.9 bits (167), Expect = 1.5e-12 Identity = 36/70 (51.43%), Postives = 48/70 (68.57%), Query Frame = 1
BLAST of CSPI01G04570 vs. TAIR10
Match: AT1G78970.2 (AT1G78970.2 lupeol synthase 1) HSP 1 Score: 56.2 bits (134), Expect = 9.8e-09 Identity = 34/75 (45.33%), Postives = 43/75 (57.33%), Query Frame = 1
BLAST of CSPI01G04570 vs. TAIR10
Match: AT1G78955.1 (AT1G78955.1 camelliol C synthase 1) HSP 1 Score: 55.5 bits (132), Expect = 1.7e-08 Identity = 31/75 (41.33%), Postives = 46/75 (61.33%), Query Frame = 1
BLAST of CSPI01G04570 vs. TAIR10
Match: AT1G66960.1 (AT1G66960.1 Terpenoid cyclases family protein) HSP 1 Score: 52.4 bits (124), Expect = 1.4e-07 Identity = 30/75 (40.00%), Postives = 42/75 (56.00%), Query Frame = 1
BLAST of CSPI01G04570 vs. NCBI nr
Match: gi|778656570|ref|XP_011649297.1| (PREDICTED: probable oxidosqualene cyclase [Cucumis sativus]) HSP 1 Score: 141.4 bits (355), Expect = 6.5e-31 Identity = 67/73 (91.78%), Postives = 69/73 (94.52%), Query Frame = 1
BLAST of CSPI01G04570 vs. NCBI nr
Match: gi|700208802|gb|KGN63898.1| (hypothetical protein Csa_1G025800 [Cucumis sativus]) HSP 1 Score: 141.4 bits (355), Expect = 6.5e-31 Identity = 67/73 (91.78%), Postives = 69/73 (94.52%), Query Frame = 1
BLAST of CSPI01G04570 vs. NCBI nr
Match: gi|659107098|ref|XP_008453521.1| (PREDICTED: probable oxidosqualene cyclase [Cucumis melo]) HSP 1 Score: 119.8 bits (299), Expect = 2.0e-24 Identity = 57/73 (78.08%), Postives = 65/73 (89.04%), Query Frame = 1
BLAST of CSPI01G04570 vs. NCBI nr
Match: gi|6045135|dbj|BAA85267.1| (oxidosqualene cyclase [Luffa aegyptiaca]) HSP 1 Score: 114.0 bits (284), Expect = 1.1e-22 Identity = 50/72 (69.44%), Postives = 59/72 (81.94%), Query Frame = 1
BLAST of CSPI01G04570 vs. NCBI nr
Match: gi|75254647|sp|Q6BE23.1|OXSC_CUCPE (RecName: Full=Probable oxidosqualene cyclase) HSP 1 Score: 99.4 bits (246), Expect = 2.8e-18 Identity = 45/72 (62.50%), Postives = 57/72 (79.17%), Query Frame = 1
The following BLAST results are available for this feature:
The following terms have been associated with this gene:
GO Assignments
This gene is annotated with the following GO terms.
The following mRNA feature(s) are a part of this gene:
Analysis Name: InterPro Annotations of cucumber (PI183967)
Date Performed: 2017-01-17
The following gene(s) are orthologous to this gene:
The following gene(s) are paralogous to this gene: None The following block(s) are covering this gene:
|