MU50987 (transcribed_cluster) Melon (DHL92) v3.5.1
The following sequences are available for this feature:
GCCGCCGCCGTCTCTCTCTCTCAAGCCCTCACAATTTTGCGCCGTCGTCTCCTGCCTCCGTCTCCCTCTCGCTAACTCCCTGAAAAAAGCCTCCACAATTTTTCGCCGCCGCCGTCTCTCTCTCGGAACGCTCTCCGGTTCAGTATCGCACGACTTTCCCTCTCCTCGCGAACGCTCTCCGGTTCAGCTTCGCCGTCTCTCTCTCGCAAGGATCCCACCAAACCGTGAGTTGCTTCTCCTCCCCCTTCCGTCCGTTTCGCACTGCCTTCATTCCTCCGTCTGGTTCATTCGCAGAAGGCTCACCAAACACCAAAATTCTTTAAATGGATCAAGAGGCTGCACGAACTGCTCGGGAATCACTAGACCTTGCATTTCATATGTCTAATGTACTTGATGCCGGGATCGATCGCCACACTCTCTCTGTCCTCATTGCTCTCTGTGACATGGGTGTGAACCCTGAAGCTTTGGCTGCTGTTGTCAAGGAACTACGGCAGGAGCCACCCGCATCAGAGACCATCATATCGGCCAGTAACAAGTCATAAGTTCCCCAAGCAAAGAAACAACTCTGTTCTTCTGATGTAGGTTGAAATACAAATGTGTTATTTAACGATGTTGGATGGCATCTTGTGATAGATGGCTTGGTGTTTAGAATGTTCTAAGTACACAATCTTGTGTTCATCCCTTCTCTATTTTAGCTGATTTTGTCGAAATAACAGAATTGGCACACATGTATTCTAATCAGATCTGTTGGAATGAGAGTGAGGGTTGATCATGTCGGTATGCTTTTCCATTCATTTACGCATTGCAATTGTGCTTCAAGCGATGGTCCCAGTTACATAGCT
BLAST of MU50987 vs. Swiss-Prot
Match: MZT1B_ARATH (Mitotic-spindle organizing protein 1B OS=Arabidopsis thaliana GN=GIP1 PE=1 SV=1) HSP 1 Score: 99.0 bits (245), Expect = 8.8e-20 Identity = 47/58 (81.03%), Postives = 52/58 (89.66%), Query Frame = 3
BLAST of MU50987 vs. Swiss-Prot
Match: MZT1A_ARATH (Mitotic-spindle organizing protein 1A OS=Arabidopsis thaliana GN=GIP2 PE=1 SV=1) HSP 1 Score: 94.0 bits (232), Expect = 2.8e-18 Identity = 44/66 (66.67%), Postives = 54/66 (81.82%), Query Frame = 3
BLAST of MU50987 vs. Swiss-Prot
Match: MZT1_PICSI (Mitotic-spindle organizing protein 1 OS=Picea sitchensis PE=3 SV=1) HSP 1 Score: 90.1 bits (222), Expect = 4.1e-17 Identity = 45/61 (73.77%), Postives = 50/61 (81.97%), Query Frame = 3
BLAST of MU50987 vs. Swiss-Prot
Match: MZT1_TAEGU (Mitotic-spindle organizing protein 1 OS=Taeniopygia guttata GN=mzt1 PE=3 SV=1) HSP 1 Score: 63.5 bits (153), Expect = 4.1e-09 Identity = 28/61 (45.90%), Postives = 44/61 (72.13%), Query Frame = 3
BLAST of MU50987 vs. Swiss-Prot
Match: MZT1_CRYNB (Mitotic-spindle organizing protein 1 OS=Cryptococcus neoformans var. neoformans serotype D (strain B-3501A) GN=CNBA1680 PE=3 SV=1) HSP 1 Score: 61.2 bits (147), Expect = 2.0e-08 Identity = 29/69 (42.03%), Postives = 44/69 (63.77%), Query Frame = 3
BLAST of MU50987 vs. TrEMBL
Match: A0A0A0LMZ6_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G094370 PE=4 SV=1) HSP 1 Score: 129.8 bits (325), Expect = 5.2e-27 Identity = 67/72 (93.06%), Postives = 71/72 (98.61%), Query Frame = 3
BLAST of MU50987 vs. TrEMBL
Match: A0A0D2TES9_GOSRA (Uncharacterized protein OS=Gossypium raimondii GN=B456_008G288400 PE=4 SV=1) HSP 1 Score: 114.0 bits (284), Expect = 2.9e-22 Identity = 55/71 (77.46%), Postives = 65/71 (91.55%), Query Frame = 3
BLAST of MU50987 vs. TrEMBL
Match: A0A0B2PDD0_GLYSO (Mitotic-spindle organizing protein 1B OS=Glycine soja GN=glysoja_038443 PE=4 SV=1) HSP 1 Score: 111.3 bits (277), Expect = 1.9e-21 Identity = 55/72 (76.39%), Postives = 63/72 (87.50%), Query Frame = 3
BLAST of MU50987 vs. TrEMBL
Match: I1J6X9_SOYBN (Uncharacterized protein OS=Glycine max GN=GLYMA_01G100100 PE=4 SV=1) HSP 1 Score: 111.3 bits (277), Expect = 1.9e-21 Identity = 55/72 (76.39%), Postives = 63/72 (87.50%), Query Frame = 3
BLAST of MU50987 vs. TrEMBL
Match: B9T1I8_RICCO (Putative uncharacterized protein OS=Ricinus communis GN=RCOM_0186670 PE=4 SV=1) HSP 1 Score: 110.5 bits (275), Expect = 3.3e-21 Identity = 53/65 (81.54%), Postives = 61/65 (93.85%), Query Frame = 3
BLAST of MU50987 vs. TAIR10
Match: AT4G09550.1 (AT4G09550.1 AtGCP3 interacting protein 1) HSP 1 Score: 99.0 bits (245), Expect = 5.0e-21 Identity = 47/58 (81.03%), Postives = 52/58 (89.66%), Query Frame = 3
BLAST of MU50987 vs. TAIR10
Match: AT1G73790.1 (AT1G73790.1 Protein of unknown function (DUF3743)) HSP 1 Score: 94.0 bits (232), Expect = 1.6e-19 Identity = 44/66 (66.67%), Postives = 54/66 (81.82%), Query Frame = 3
BLAST of MU50987 vs. NCBI nr
Match: gi|778668078|ref|XP_011649034.1| (PREDICTED: mitotic-spindle organizing protein 1A-like [Cucumis sativus]) HSP 1 Score: 128.6 bits (322), Expect = 1.7e-26 Identity = 67/72 (93.06%), Postives = 71/72 (98.61%), Query Frame = 3
BLAST of MU50987 vs. NCBI nr
Match: gi|659082266|ref|XP_008441751.1| (PREDICTED: mitotic-spindle organizing protein 1A-like [Cucumis melo]) HSP 1 Score: 125.9 bits (315), Expect = 1.1e-25 Identity = 66/72 (91.67%), Postives = 70/72 (97.22%), Query Frame = 3
BLAST of MU50987 vs. NCBI nr
Match: gi|823215102|ref|XP_012440309.1| (PREDICTED: mitotic-spindle organizing protein 1B-like [Gossypium raimondii]) HSP 1 Score: 112.8 bits (281), Expect = 9.4e-22 Identity = 55/71 (77.46%), Postives = 65/71 (91.55%), Query Frame = 3
BLAST of MU50987 vs. NCBI nr
Match: gi|763785935|gb|KJB53006.1| (hypothetical protein B456_008G288400 [Gossypium raimondii]) HSP 1 Score: 112.8 bits (281), Expect = 9.4e-22 Identity = 55/71 (77.46%), Postives = 65/71 (91.55%), Query Frame = 3
BLAST of MU50987 vs. NCBI nr
Match: gi|356496066|ref|XP_003516891.1| (PREDICTED: mitotic-spindle organizing protein 1B-like [Glycine max]) HSP 1 Score: 110.2 bits (274), Expect = 6.1e-21 Identity = 55/72 (76.39%), Postives = 63/72 (87.50%), Query Frame = 3
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
GO Assignments
This transcribed_cluster is annotated with the following GO terms.
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of melon unigene v4
Date Performed: 2016-11-16
|