MU60441 (transcribed_cluster) Melon (DHL92) v3.5.1 | Cucurbit Genomics Database (CuGenDB)

Overview


Name	MU60441
Type	transcribed_cluster
Organism	Cucumis melo (Melon (DHL92) v3.5.1)
Description	No hit
Location	chr4 : 25608529 .. 25609687 (-)
Sequence length	310

Genome Viewer

Sequences

The following sequences are available for this feature:

transcribed_cluster sequence

TGAGAACTTCTACTTCGATCAAGATCTTAAAATAAGGTGTGTATTTTCTATTGAAAATTAAAGGGGATTTGGGAAGGGGATTTCAAATTTGAAATTCTAGTGAAATTCATCAAGATGGCTGATGGATCAGTTAGTACCCCAATTATTGGAAAAGAAGAGAAGACAAAGGTTGAACTTGATTGGGAAGTTGTTAAGGTGGATAAAGAGGTTGAGAAAGAAAAGCTTGAGGTCAAGATGAAGGAGGTAAAACATGAAGATGACAAGAAAGAGAAGACAGCAGCCAAGCTTCAAAGAAAAAGCTCATCAGTAC

Library


Library category	ESTs
Melon mature fruit library	1

Homology

The following BLAST results are available for this feature:

BLAST of MU60441 vs. NCBI nr


Match Name	E-value	Identity	Description

Annotated Terms

The following terms have been associated with this transcribed_cluster:

Vocabulary: **INTERPRO**
Term	Definition

Relationships

This transcribed_cluster is associated with the following gene feature(s):


Feature Name	Unique Name	Type
MELO3C026881	MELO3C026881	gene

The following EST feature(s) are a part of this transcribed_cluster:


Feature Name	Unique Name	Type
FR10I11	FR10I11	EST

InterPro

Analysis Name: InterPro Annotations of melon unigene v4
Date Performed: 2016-11-16


IPR Term	IPR Description	Source	Source Term	Source Description	Alignment
None	No IPR available	unknown	Coil	Coil	coord: 27..61 scor