CU085233 (transcribed_cluster) Cucumber (Chinese Long) v2
The following sequences are available for this feature:
AGTTATTAGTAAATGTTGGGCATTGATGTTTGAACTTTTCTTTGAAGTGGAGAAAGGACAAAGGAATCGCTACCACATGCATGGCTGACATTAGCATGGTTTTTTTCAAGAACGATAGTAACTATATAATATAAAAGACAGAAATTGAAATTAGCATTGAGGAGAAGCCAAAAAGGCATAATTATTACAATAAGAACCTCAACGAATGGTTACTTTGTGATTTCATTTTCTACTACAGCAGCCTCCATTCGGTTGGCCATCGACCTCAATCCCACTTCATACTTCTTCACCAAATCCTCCAGCTTCAAGCCTTCCACTGCCTCAACCTCAAACCTCCACTCAATCATGCACCCACCCCCGACCTAAATAGGACCA
BLAST of CU085233 vs. TrEMBL
Match: A0A0A0LPR8_CUCSA (Uncharacterized protein OS=Cucumis sativus GN=Csa_2G373500 PE=4 SV=1) HSP 1 Score: 100.5 bits (249), Expect = 1.5e-18 Identity = 49/49 (100.00%), Postives = 49/49 (100.00%), Query Frame = -2
BLAST of CU085233 vs. TrEMBL
Match: A0A166FHD6_DAUCA (Uncharacterized protein OS=Daucus carota subsp. sativus GN=DCAR_008621 PE=4 SV=1) HSP 1 Score: 58.2 bits (139), Expect = 8.5e-06 Identity = 26/42 (61.90%), Postives = 32/42 (76.19%), Query Frame = -2
BLAST of CU085233 vs. NCBI nr
Match: gi|449461385|ref|XP_004148422.1| (PREDICTED: lachrymatory-factor synthase [Cucumis sativus]) HSP 1 Score: 101.3 bits (251), Expect = 1.3e-18 Identity = 49/49 (100.00%), Postives = 49/49 (100.00%), Query Frame = -2
BLAST of CU085233 vs. NCBI nr
Match: gi|659088483|ref|XP_008445005.1| (PREDICTED: uncharacterized protein LOC103488175 [Cucumis melo]) HSP 1 Score: 89.7 bits (221), Expect = 3.8e-15 Identity = 43/44 (97.73%), Postives = 44/44 (100.00%), Query Frame = -2
BLAST of CU085233 vs. NCBI nr
Match: gi|719979590|ref|XP_010249529.1| (PREDICTED: lachrymatory-factor synthase-like [Nelumbo nucifera]) HSP 1 Score: 61.6 bits (148), Expect = 1.1e-06 Identity = 25/44 (56.82%), Postives = 35/44 (79.55%), Query Frame = -2
BLAST of CU085233 vs. NCBI nr
Match: gi|502122436|ref|XP_004497745.1| (PREDICTED: lachrymatory-factor synthase-like [Cicer arietinum]) HSP 1 Score: 59.3 bits (142), Expect = 5.5e-06 Identity = 26/41 (63.41%), Postives = 32/41 (78.05%), Query Frame = -2
BLAST of CU085233 vs. NCBI nr
Match: gi|1021050004|gb|KZN07784.1| (hypothetical protein DCAR_008621 [Daucus carota subsp. sativus]) HSP 1 Score: 58.9 bits (141), Expect = 7.2e-06 Identity = 26/42 (61.90%), Postives = 32/42 (76.19%), Query Frame = -2
The following BLAST results are available for this feature:
The following terms have been associated with this transcribed_cluster:
This transcribed_cluster is associated with the following gene feature(s):
The following EST feature(s) are a part of this transcribed_cluster:
Analysis Name: InterPro Annotations of cucumber unigene v3
Date Performed: 2016-11-16
|